Description :
From Genome Similarity Track
Location :
Scaffold_3:116962- 118112
Sequence
1150 bases(100 bases per row)
TGACCTCAATAATGGCATTGCTTCACTTCTTGATACCTATTCTTTACAATATCACACCAACGTATGCAGAGGGTTCGCCAGGGTCGTTTGTGGGATCGGA
CATTTCCCCAAGATCCAGGCCGACCGGCCATAATACTTATGTGTGTGTCATATTACTTTTTATCATAATTGCAACAGAACTTCAAATGATCAGTAGTGCT
CTTCTCAGACTTATTGAGTTTATTTGCCCGAAGACAGCGACGAAAGCAACCAAAATCCAGTCACCATACGTGAAACTAGAAAAAAGACCTTTCAGTGCTA
CATTGCACCATCAATCTCTCGCCAGCGGCGTAACAAGCTGTGCCAGTTACGTGACCTTTACGCAAGATAAAAATAAATGGTAATGATTTGTTAACAAATG
TTTCTCTTTTACGATTAAATCAGGAGACCATATTCATTGCAAGTGGTAATAATTGCTAATTTTTTTCATTGGTGGGTAAGGACAGCAATATCAACCAATA
CTACCAGGCCACGGCAGACGTGCGCGATGAAAAATGAGCAGATAGTGACAATAGCTATTTGCATTTAGACGCTAATAAGAGAAGATTGAGTAGAAATCTA
TTGACATACGACTGGTATATTGTTTACACTCTAGTATTTACCTTTACGAAGTGCCCTATATCGTAAGATAAGCTTACTCTGCAAGCAAATGAACGCGAGG
TCTCGAGGCACCAGCTTGTACTGTCATCAGTGTGAGTTAGTTTCATCGTGTCTATAAAAGCGTGGACGACTTGTTACTCCTCGTAGTACTTCGTACTCCG
TCGAAAGACAACGAGGAACCATCTAGCATTAACGCGTTGGATGATGGAGAAACCCGCTCTCACTCTACGCGTGACGGCGTCTCCATCTAGGTTAATCTGA
AGGAAATGACGTCGAGCTGATGGTATCAAAATGTGGCAAAAAAAACATTAAGATCTTGATATCCACTTCATGTGGATACACGCAACATCACCATTGCCAA
GTTCATCCAGATTTAACTTGACACAGAACGGAAAAAAGATGGCTTGGCTTCACCAGCAACCAGCAGGCAAATCCATAAGACAAAAAAGGCTCACGCTGCT
GATTTTGGGTTGTCACCTAATCTTCAACCCAAAATCTTGATGATAGGCAC