Description :
From Genome Similarity Track
Location :
Scaffold_250:11696- 15520
Transcript NameFunction/comments
Phyke_g7219hypothetical protein

Sequence
3824 bases(100 bases per row)
CTACGGAGTCCCTCAGCAATCCGATTGGTTTTCACTCTGGCCAAATTTCTCTCGTGGTGGCGTCAGAAAGCGTGGCATTGCTGCGTCTACTTCTAATGGA
CAAGATGTGGAAAAAAAGAGTCGCGGAAAATTTGTGCAGTGCTATTCACAACATCACACCGTTCTTGACCAGAAAGAACCTGGGCTCAACATCGCTGGGC
ATGAAACCAAATGCTAATCAGTCTGATATTCGTCTCCGAACGGCGATTATTCGGGCTGTGGGCGCTCTGTGTGTTCTTGGTTCTCACTCGGATTGTATAC
GCATTGGTGGGAAAGTAGTCATTGCTGCACAAAGCCCAAACAGCAATGAGCCCGAATTGAGTGCGAAtgatagctatacatatgTTGCTGGCGGTGCTCA
ATCGGTGAACGCAACTTTGATCGGTATGAACTCGAGAGCATCGACTGTTCGTGTTGTGTTTCACCCTTCTTCTGAAGAATTTGAGTTTGATCCCAGCCAC
AATGTCCAAGATGTAAAACTCTCTGCTCTGTCCCCAACAGAAGAAATCTGTTTGTCACCAGCGGCTGTCCCGCTCACATTGAACATGATGCCAATCATCA
TTCAACTTTCGTCGCTGGAGGAAACAAGTATTCTGAAGGAGTTTGATAGCCTTTGGAGGCTTCAAATCCGGTCACGTGCACTGTTAGCCCTCGAAGCTCT
TTTGCATCATTCGCTTGATGTGACGAAGAGTATCGCGCACGATGCGATGACAAAGAatcttcttcgctttgcaCTAACTCCCACCAGCCTCAACAGTTTT
GTGAGTCTACCGCACTTGCAGGAGCGAGGCCGAATGGTTCTCTGTCGCTTGATTGAGTCCTCGACGCCGCTGGGTAATACCATGTTCCACAGATTGGCGG
AACCTAAGGCTCCGGCACTCGTGGTGTCCGAATCAACGGGTCCGTCGGGCACAAGCGGTGCTGACGTTAACGATGATcctgctcaagaagaaactgaagc
acaTCGTGTCCGTAGGGGATTTGCTTCAACTCTGGCTGCAATGGGCTTTGAGTTTGACTTGTGTATGGCTGCGTTAGACCACGCTCGTGACGATCCTAAC
CTGGCAGTTGAGTGGCTAATGGGTGATGGTGCAGCGGCGTACCAGGAGCGACAGCAAGCACAACGACTAGCACAGGCAACCATTGAGGCACACGAACTAG
GTGATGGGGTGGAAGGGGGATTGAGTCTTACATTTGAAGAAAAGGCGAAAGAGCTTCAGAGTATTTCCGGTATGCCATATTGTCTGGCGCTATGTGCCTT
GGAACTCTCGAATAATGACCCTAACCGTGCTATGGAATGGTTAATGGAAAATGGCACGAACTATGCTGAGAGATTCGACTCGTTGGATCTTTTAACAGAC
GCGTTTTCCGCCGGGAGAACTGTGGTACTAGAGGATCGAGCTGCGATGGAAGAAATTGATCAGCCAGACCCACTTGTGACGACTTCCGATCACCCAGGCG
GAATAGCTGCCGAGCACCTGAGCTCTTTTGCGTCAGTGCGCAGCGCACAGTTGTCACACACTGTTAATATCGATGCGATGGCGGCAACACTAGCCCCAAT
CTTGGCCCCGGGGCCTTCAAAAGCTAGCTTAACTGTCGCAGCATCATCTGACCCGAGCATGGCAACATATGCGCCACTAGATCCGGAGTACTTGACTCCA
AATATTCTTTTAACTGTCAGCAATGACATCGGCCCTGTTCAACGATTGGCTACTAGTGGGCGAACGGGTATCTACAGACGCTACTCACAGGAAGATGGTG
TGTTAATCACTTTCTTGAACCCGGAGTCGGGCGCGTATGAAGACGAGTGGCATTTCCCGAGGGATATACGACGAATTGTGAAAATCTATGATGAGCCGTT
GGAAAGTGTGGAAAGTATCCATCGCGTTGCTATGAGAACGGAAAACGCGCTTTCTACGTATTACGCCAGATGTGCAATCACAGCTCTACTCCGTTCGTTT
GACCCCGCTGCAGAGGCTATAACAGTGCCGGTGGACTGTGCGAGTGAAGGGGCACATGTACTAGTAGAAGACAAGGCTCTTTCGATGTCATACTCGAGTA
AGATTCTGAAAGTGGTTGGTGGGCCGCGGCAGTTTGTAAGTCTGCTCAAAATGGTGGCAGCATCAGAAATCAATTCTACCCAGCGCTCGGATATCGAGGG
GAAAGATGCCTCTGAAATAGATATCAAACCAATGTCAGTAGGTGAAAGTGGTAAGTCGACGGCCGAAGATTCTGACGTACCCAGGTCGTTATTGACAAGC
TTGCAGGCTATTACGCTGAGGATGCTTCGTGAGGAAGCACGCACAGGAAAGTTCGGAATGTCTGAGCTTTCGCCATTTCCATCGCAATCCAGTCCTCCGA
AGCAAGACGCGTCAGCTGACCCACGCATGGACCTAAAACGTCTAGACTGCAGCCGTTCTGTACTGCAGTCTCTTCCTGAGAGTTTCCCCGAGTATGATGA
TGcaaatgatgaagatgaagcctTGAGCCGGGCTATTGAGCTGTCCATGCAAGATACTGCAGCCGCGAGAACTCCACCTGCTCCTTTGACAGCTTCTTGT
GCGAGTGGGTGTCTTGATAAAGAAAGTAAAGATGAGGACACCACTATTGCATGCAGAATGGGACGAATGCGACAGCCTTCCGACAccgaagcacaagaag
ttGCCAGTGCCTATCTTTGTGGTGGGATGGACGACCATGACGGGTTAGTATCCAGTGTGCTAGTTAAAGAGTGCGTCAGTCACTTTGTTGAGTCCACACG
AATGGCAAGCGACGGCACGAACGAAGCGTCGGCGATACAAGAGTTCCAATCATTGCATCCGTACTTTGGCAGGTGTGAGTACGCTCGCGGGGTGAGCATT
GACAGCTCATATCGCTGTTTACGTATCGTATTTGACCACCGCTGCCGACTCGGAACCAAAAGTAAACTGACATTCTTCACAGACCCGGAGTGTGAAGACC
GCATTGGTGTCGTAGACAATGCCATGACGACTTCTGGTCACTTGCTCCCTGACCTCATTATTCATTCACATCAGTTTTGGTTCCGTTTTGTGGCTTCGGA
GGAGAATGTCATGAAAGACAACGGTTATGGGTATCGCTTCCAGGTAAAACCCATGGCTAACATTCGCTGGACGAAGGAGACCGAAGTACTGGCTAATCCG
TCACTCGAGTGGGCGTGCTGGGTGCTTAAGCTTCTTCTTAACGATGCGACAGAGCTCTTGACTCATGGAGCTGTGCACAACCGTAAGATTTATGGTGCAC
TTGTGCGTTACCTGCGCTCACCAGGAGCCCCATTCAAGGGGCGTGTTGTGCGTTTGCTACAGCAGCTACTGGACCACCCCGAATTTTTCCCGATCGACAA
CGTGCCCGAACTCGATGCCCTGGAATCCATTGCGCGGCTCGCTCTAACACGTGCAGAGGTTGACAGAGCGAGTAATAAACATTTTCTTTCGTCCCATCTA
CTGCAGTTGGTGGAGCTGTCAATGGTACTGTCAACCGCAGCACCGATCTTCAAGCGCAAAGTGGAAGGTGTCAGTCCGACCTCTCCGCCGCTTGTATTAA
CACCTCTGACCTTACCGGTTCCGTTTGAGCGAAAAAGTGTGCGTGATAGTCTGAACGATGTATCGGAGCTAACAAGATTCTTGTTGGGGAAATCGACGTA
TCTGGCAACGCATATTCTAGTGGCTATATGGCTGGAGGTGTACGGCTGCTCTACGATTATCGAAAGCTCACACCCGTACATTGTTGGAGCTTCACTGACT
GGCTCAGTGGTATATGAAGATGCG