Description :
From Genome Similarity Track
Location :
Scaffold_3:116924- 118038
Sequence
1114 bases(100 bases per row)
CTACATTGTATTTACTGGTAGAGCAGGATACACGGCAATGACCTCAATAATGGCATTGCTTCACTTCTTGATACCTATTCTTTACAATATCACACCAACG
TATGCAGAGGGTTCGCCAGGGTCGTTTGTGGGATCGGACATTTCCCCAAGATCCAGGCCGACCGGCCATAATACTTATGTGTGTGTCATATTACTTTTTA
TCATAATTGCAACAGAACTTCAAATGATCAGTAGTGCTCTTCTCAGACTTATTGAGTTTATTTGCCCGAAGACAGCGACGAAAGCAACCAAAATCCAGTC
ACCATACGTGAAACTAGAAAAAAGACCTTTCAGTGCTACATTGCACCATCAATCTCTCGCCAGCGGCGTAACAAGCTGTGCCAGTTACGTGACCTTTACG
CAAGATAAAAATAAATGGTAATGATTTGTTAACAAATGTTTCTCTTTTACGATTAAATCAGGAGACCATATTCATTGCAAGTGGTAATAATTGCTAATTT
TTTTCATTGGTGGGTAAGGACAGCAATATCAACCAATACTACCAGGCCACGGCAGACGTGCGCGATGAAAAATGAGCAGATAGTGACAATAGCTATTTGC
ATTTAGACGCTAATAAGAGAAGATTGAGTAGAAATCTATTGACATACGACTGGTATATTGTTTACACTCTAGTATTTACCTTTACGAAGTGCCCTATATC
GTAAGATAAGCTTACTCTGCAAGCAAATGAACGCGAGGTCTCGAGGCACCAGCTTGTACTGTCATCAGTGTGAGTTAGTTTCATCGTGTCTATAAAAGCG
TGGACGACTTGTTACTCCTCGTAGTACTTCGTACTCCGTCGAAAGACAACGAGGAACCATCTAGCATTAACGCGTTGGATGATGGAGAAACCCGCTCTCA
CTCTACGCGTGACGGCGTCTCCATCTAGGTTAATCTGAAGGAAATGACGTCGAGCTGATGGTATCAAAATGTGGCAAAAAAAACATTAAGATCTTGATAT
CCACTTCATGTGGATACACGCAACATCACCATTGCCAAGTTCATCCAGATTTAACTTGACACAGAACGGAAAAAAGATGGCTTGGCTTCACCAGCAACCA
GCAGGCAAATCCAT