Description :
From Genome Similarity Track
Location :
Scaffold_252:11685- 13222
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_252-snap-gene-0.6DNAJC13 protein

Sequence
1537 bases(100 bases per row)
CAGTTCCACTTACCTCCAAGATGAAACCCACAAATTCCTTCATCGCTGGTGGTGCATGCAGCAATCGATAGAGCGTTTGCAAATACGTTATGAGAAACGG
CTGTCGTGGCCCGTGGCGGACGACAATGTCTCGAATCTCTCTCGCAACATAGAAAATCGCCTTGTCGAACGGTTTGTTGGGCTGTGCAATGACGCCCACC
GTCGGCGTGTTAGCGTTGAACTCGAGTGCGAGCGTGTGGAAGCCTTCATCCAGACCCTGGGGTAGTTGCCGCTGCGATCGCGCTGTCTTGCTCGAGCCGT
GGGTCGCCAAATGCTGCAACAGACTGGCCTGGATAATGCGTAGCTCTCGATCCGTGGCGTGGAGCTCCTTGTTGGCTTCGCCTCCTACTCCATGGCCGCC
ACCACTACCCAAGAGCTTGGCGCCCTCCGACTGGATCATCTTGCACGGCACCATGCGCAGCGCATCTGGCACTCGCTCAATCGTGATATCGACCTGTGTG
TTCTGGATCGCATGGCACGACGCGAGCAGCTCCGTGAGGAGCCGCTCGCGTTGCGGCGAATAGAATGTGCGGCGAATACTATCCACGTACACAATCTCAA
ACNNNNNNNNNNGTGAAGTGAATAGAACGTGCGGCGAATGCCATCCACGTACACAATCTCAAACGCCTCGTTCGAGTCACGAAACATTACGAGCGAAAAG
ATCCGCGCCAGCGGGCGGCTACTGATCACAGCACCGTGGTCTCCATATTCGGCAAGGTACGTGTCCGAGGCCGCCAAAACCCGCGGCGCGAGCGGCTTGT
TGGTCGCCGACACAGGCGTCACGGGGTACTGCCACAAGATTTCCGGTGGTTCGTCACTACTGGTCGTCGTCACCTTGATCGCCGCCTCCATCGTCTTCTT
GCGGTACTCGTTGATCTCAATGTGGTACGCGCGCATGACGCGGTGGATCGCCTGCGCCATCTCGGTGCGCTGGCGCTTGTCCACGACAAAGAGACTCGAA
CTGTCCGAGTGGTTCAGCACAATCGCGTTGTGGTCGTCGCACACCAGATCGATTGAGACGAGGCTAGTGTACGGAATGTGGCTCAGCAACTCGCCTTCGT
CGTCGCGCTGGTTGACGCCGTCGGGTCCGATCTCGACCACGCACGGCGACTGCAGGCCGCGGTGATGGTACTTGATACAGGAAAAACCCTCCGACCGCAG
CTCGGGCAGCAGCGCGCGGTTAGGCGTGCGCGCCTGGTGCTGGCTGCGGAGTCGCATGAGGCACACGAGCACGTCCATGCGGTAGGGACACCGATAGACC
GTCTTCTTGATGCGGTGGCGCGGCGTCGCGATCGCAAAGTCGGTCTCGCTGCCGTCGAGCGGCGTGGCGCTTTCGACGTCGGCGTACGACCACGAGTTCG
TGACCTGTTGCGTGTCGAGATCGTACGTAGAGAAGCCGTGGGCCGTGAAGCACAGCACGCGGCCCTTGACGACAAACGCGCCGACCTTGTGCACCATAAA
GCGCGCGATGTACGAGCGCACGTCCATGGTGTTGCGG