Description :
From Genome Similarity Track
Location :
contig_29:116821- 117973
Transcript NameFunction/comments
g5722.t1conserved hypothetical protein

Sequence
1152 bases(100 bases per row)
GTTTGCAGCGCTGGACGAACCAAGCAACTTCAACATCCGTTATCGAGCACCGGCACCAGTAACGGTAAACTTAAGTTTTTTAGTGCATGCGCGTTCTGCT
TGAGTCCTCCTCAATGTATTGCAGCGGGCGTCCTCGTCGCCGGCAGCCAACGCGGTAGCGCGCTATCGGAGCTGCACCATTAGCTTCATCATATTGTAGG
CAGGAGTTCACAACTTCAGCCACAACTTCAGTCTTCAGACTGTAGCCATCTGCTCGGATGAGTTCACGCCAAACAATCATTTTTTGTATGAACTGGAACT
GGAATTCAGAAGGCCTTGTCGCTCGCTACCTGGTGGCTGTCCCAGCAGCATGTCTTCTGCGAGAAGCAGACTCACACATCAGTAGCAGGCGATTGACATC
CCGGGGGTAAGGAAAAAAACCCATCAGATTTTAGACGTTCTAAATGATGTCCTTATTTATCAGTCCGCACACTAATAAGGTCCATGGAATCACACACTTC
GTGTAGCTTATTATCTTAGTCGCGATATACTGCTCGCCGGTTATCAGTCGGGTGTATGCCATTGCAACCTCCAGAGCTGCGATGAGGTCCTGTTTTTCAT
CCGTGAAGCGTGCTGGAGAGGTCGCAAGACGCGCAGTCCATTATTCAGGCGAGTCACGGTACTCTCACATAATTTGGAATTGAATGCCACAACTTGATTA
CGGCTCTGGGTTGACTTCGCATTCCATTCAGCGTGCTGGATCTCACTTCAGTTTTGCCGACTTCCAGGGCGGAATCATCATGGTGAAGGTCGGCGAGGAC
GAGGACGAGGGAGACCAGGGCCTGACGACCAAGGACCAGAAGGCGACAACAGCAGCTGCTGCAAACCCCATGAGTCCGCTCTCCTCGGAGGCGCTGATGC
TGCGCGAGCTGGAGCTGGCGCCCGTCCTCATGTACCCGCAGCAGGTCTCGCGCGCCACCGAGATCCGCCTCTTCCTCTCGCGCATCGAGTGCATCGCCAT
CCACCAGGTCATCGAGCGCGAGGAGGGCGTCGTCTACTTTGTGCTGGATGTGTACCGCTACCGCCTGCAAAAGGGGCTCCCGTGCACGCGCAGCCGCCGC
CGCAAACTGTCGGCAGACCGCGAGCCCGAGGACCGCGGCCCAGGACTACCAG