Description :
From Genome Similarity Track
Location :
Scaffold_141:11681- 13698
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_141-fgenesh-gene-0.7Glycoside hydrolase

Sequence
2017 bases(100 bases per row)
CTTCACTTGGTTTCCGAGCTTGTCCATTGCTGCAGTCATCACCACAACAAACACGCAAAATGAAATTAGCAAGCGAGTCGGCTTGAAAAGATGCAGGTAG
TCAATATGAACCAGATCGTACCGCTCTTCTTCTTCTGCGCAATCACACCCAACACAATGAACACCACGAACATGATACCCAGGAAGGCGCCGACACCGAC
AAACACGATCTTCGGCGCGTCCTTGCTGCTCGCCAGCGTGCTGCACGTGCTGATATCCTTCACACTGCAGTCACTGCCCGTGTAGCACGTCAAGCAGCTG
CACTGCTTCTCGCCATTCACGGTCAGACACTGACCATTCTCACCACAGTCCGACGACACCTTGCAAGTGTCACCACCGCTCGCGACTTCGTACGTGCCAC
ACAGGTCCTCCTCCGTGGTGCCAACCTTGTCAGACACGGCGACATCGCATTTGCCACCGCTGTCGTCGCAGACGATTCCTTCACGACTCTTGGCGACCCA
CGTGTCCGTGTCCGCAACTTTGAGGTAGGACGCCGTGCAGCTGTCGGGGATCCAGCCATTCGCCGTCGCGCGTGTGTTTGTCGCCAGGGTCGTTGTTTCA
AGGGTTGGAGCCCACGTACACAAGGTGCTCGAGGTCCAGTCGGCCTTCTCGGTAAATGGTGTGTACTTCGCGAAGCTGGCTTTCAAGTTGGTGTAGTCCA
CGGATGCGGTCGTACTCGGTTGCTTCAATGGATCCTGGGAACCACCTATTGTATATCAAAGAAACATTTCCGGGATTCGTTGTGAGAAAGAGAGCACTAC
ACAGTAGCAACAACACAAAAGTTGCGACAGGTGCCGTACCAGTGAACATCGGGAACTTGGCATCAGGAGCGAGCTTGGCTTGACCATACGAGTACGCCAG
ACCACCAGAGTAGACCTCCGACACCAGCTTCGTATCGGCCGGCTTGCCGTACAGGTACGGAATCATCCCCCAGTCACGCGGCACCGCAGCGTCTTCTTTA
CAACCATATTCACCAAACGCGATCGCGATCGGGATGCCCTGTGCAAAGTTGATGAGGCGCTGGTAGGCTTCGGCAAAAGTCGACTTGGGGCACCAACGGT
ACTCGTTAATCAGGTAAATATCGATACTCTTCTGCATCGAGCCGTCCTTCATCTTGTCGCCACAGAGCAGCCCCTGGACCTTGAGCACATGGTAGTCGTC
GGCATTGTCGATCTTCCCGGCGTAACTGGAGTCCGCAGCCGCGTACGCGAGCGGCAGGATGCGCATCTTCTTGCCGTTCACGCGCATCCAGTTCTTCAAA
TCCGCGACGTACTGCTTCACACACGCGGCGGCGGTCAGGTCGACTTGCATGATTTCGTTCGCCACGATGATACCGAGCGTGTTGTCGTACGCAGCAAAGT
TTTTCGCGATCTACCCAAGATGCAGAGACACAAAGACAGGAATCAGATTATGTCAGATGACCATCCACAACATGGATGTATAGGCGGTTGCATTCAGCGC
TCACCTTCTTTCCGTACTCCAGCAGCAGCGCCGGGTAGCACGTCTCGGTCTGGTCAACGGTCTTCACACCGTTCGAGTTCGTCGACACCTTGCCGTCCGG
GCCGAGCGCCTTCGTGATCGTCGAGTAGCGGTACTTGCCAAAATACTCGTCGTTGTCCGGCGACGCTGAAACCAGCACGTAGACGCCGAGCGCCGCCATG
TCGGCCATGAAATTCTTGTACGACTCGTCCGGGTTGATGTTGTACACGCGCAGCGTGTTGAACTCCAGCCCCTTGAGGTTCTCAGCGATCACTTTCTTCG
AGTACTTGTCGTAGTACGTGTCACTCACCGCGTACTCGTAGGTCATCTAATGGCAGTGCACACACATATACGTACACACAAATTCGCATCACTCTCATCC
ACACTATTTAATAGGCACTCTGTAGCTTCAACGTACGCCCTTGATGAAGAAGCGCTCGCCCGTCTTCTGGTTGTACATCTTGTTGCCGCGCACGAGCACC
ACGCCGTCCGCGGCAGC