Description :
From Genome Similarity Track
Location :
Scaffold_642:11680- 13025
Sequence
1345 bases(100 bases per row)
GCCTTTGCTTTGAGCTTTGAGTCACCGCGCGTGAGGCCCCTCAATGTGAGGGAACCATTACAGACCGGCGATAGTACAGTGTACCTCACCATGGGTGGAG
GTTCCACAGATGCTGGCAGCGAAATCGTACGAACAAATGCCCTCTGCACCGGACCAGTAAGCGTCTTTGTCTTGTCAAGTGTTCATCACCCACCCACATC
TATACTCCAGCTCTCCCACAGTGGCTTCAGTATGGAGTGGATAAGTGCGTGATCATGGATGAAGCGTTTGTCTTGAGTGTCTCCTCGCTTTTTCCAACGG
TCTCCGATACGTACGCTGAAGTTCAGTGTTAAGGAAGTATGTATTCAGAGTCAGCACCTCAACACTGCACCGACCGGTGTACTGTAGCGATTGGGCATCT
GTTGGCCAGTTGTTCATGTAAACCGAATGGACGTCGCAACCTCACATTGCAGAGAGCAAAGAGAGAGTGCGCAGACCCCGCTACCCTTGTCCACCGCAAC
AAAGCAGCTCTGTTCAGTCGTCAGCAGCGTACGCTTCAAGCAGCGGAGCCTTCATTCTAATACTTGCACTGACTGGCGGCCAAGCAGTGCACACGAGTAT
TACGCCGTCAAGAGCTACAGTATCCCGGCACCGCGGTAGCCTGCAGCGATCACCATGGTCGTGCCGTTTCCCGTCCCGCGTAGTGAGCTGCCGCAAGTGC
ACGCGAGCGAAGCCGAGCACCGCGCGCGCAAGGCGCAGCTCCAGCGCATGCTCGAGTCGCTCATCGACGAGTACGAGCGGTACACGGACCGAGACCTTCG
CAAAGTCGACACGCGGCGATGGAAGTCGAGCGCGTCGCGGGACCGCCTCANNNNNNNNNNNNNNNNNNNNNNAGATCTACAAGGAGCGGTCGAGTTATGC
ATCGAAGCATACCCCAGTCGACGGCACCGACGACCACACAGACTGCGCTGCACTGGACAGTACCGACAGCGTCGACAGCGTCTCCGGCCCGATCGAGGAA
GGCGCCGACAATATGCGCATGTCGCTCATGATCGGCGACTGCACCGGAAAAGTGGAGAACGCCCTGTACGCCGTCAACGCCATCGACCAGAGCGAGCTCG
CGATGGCCAACATTTTCCTCCATGAAGACGTGGCCGACTGTGCGCTTCTCCACATCATGGAAGGACCGACGCCAGACGACCCGTACCATTTCCTCGGGTA
CAAGTGGTTCGTGCGCAAGTCGCCGTCGCACCTCCTGAAGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCACCGCGACTCGGTGTACGTCGAAT
CGATTGGGCTCACCAAGACCCGCTCGGGCGACAAGCTTGGGTACC