Description :
From Genome Similarity Track
Location :
Scaffold_2172:1168- 2805
Sequence
1637 bases(100 bases per row)
GAGCTTGCTGCCCTTTTTCTCGTCTACACGTGACCTAAGGACATAGTCCCCCACGTCAAAATTGACTGTATTCTCTCCACGCTCCCGCTTTTTGCTAAGG
ATGCGTTGCTTTATTAGAGCAATACCACCCGTTCCGACTAAACTAAAAGTCAAATCAGCAGACCAGCCAACACATAAAGTTGTGGAGGGCGATTGTTCAT
TGGTGTTAAAAACGGTTCGTTTTGGGCAAATAAAAGCTATCGCTCTACCAAATATAGCAAGCATATAATCAGCGACTATTCAGTTATCTTGACTTTTGTA
TGAGCGTTTGTTGATGTTTAGTCGGGGTTTGGTCGAACCCCTCAAACTTATATGCTCGTTTAAGTCCGGTACTTTAGGTTTAATTTAGTCGGAACGGGTG
GTATTGCTCTTAGCCGCTGATCAGCTATGGGCTGATTCATTGTGCGCAGGCTGTCGCGCAATGTGGCCAAATGCTTGGAGATAGCTGCCGAGTTGGACGG
CAGCTTGACCAACTTCTTGGTGTTGGCGTGGTAGAACTCTGCCAGTGGTGTTGGACACGACAGTGAACAGCTCGACCGGGGCTCGGTTGCCGAGCGATGG
CACAGCAGTGTGGTTCAGGCTAGATTGCACTAGGGGTACTAACTAGAACCAATCCTTAGTAGAGATTTTATACTCTAGAGTCATAGCCCGAAGCACTTGT
AAGACATTGCGGTTGACGCGTTCCACAGAGCCATTAATCCAAGGACTGTAGGCTAGAGTGAATGTCTGTTTGCTTTTGAGTCTCTTGGAGTGACTACCGT
TGTCACTCACCCGTACTGGTGGGGCGCCAAACCGGCTGTGCCAGTCTAGAATAGCTGCCGTGGCAACTGTACTGTCTGCAGAGTCGCACACGACTAGCTC
GCAGAAATGAGCGACATGGTGTTTAAGTACTAGCAAGTACTTGCTTGTACCAAACGACTCACCTATGAACAGGAAATCCCAATGTAGGACTCCATTTCGT
TCATTGCACTCAATAGTCTCACTCCATGGCCGATGGACAATTCGTCCACCCTTCACATGTGGACAGAGTAAACAGGCTGACACAAATGCGTGCACCACAC
CCCGGATGTTGGGGATGTGAAATAGGCGACGTAAATGATTAACCATGGCCTGCTCACCGCGGTGGCCTTGGGCCCTACAGTGAGCGATGACACACCGTCG
CTGGGTCAAACCCGAACTGGATCGGGAAACCTATATGCGCTGGTCCACCCGTACCACGTTGTTTTTGCCTTTGGTCGAACCTGCTGGTGCCTGGGAACTG
CTTCTGCGCAGccatgatctcgtccagTGATGACCAGACGAAACCattgtcgtccagcggccGGAGGACCTGTCTTGCGTGAGTCTGGGGCGAaggcagc
tgctgcttggcttTCTTTCTAGTAAAAGGCTTCAATTTaaccttcgtcgtcggctgcCCAATCCACCTGAACAACATGTCCGCCCACACATTGGAAACAC
CATCGACATGTTCGATAATGTAGCGTAGAGGCATCAGCTTCAACGCCCATCGAAGTAACTTACCCCTAATATGCTTCTTGTACCCGTGTCAGGTGCGAAG
GCATGGATGATGTTACGGTGGTCGCAGAATAGCCGAA