Description :
From Genome Similarity Track
Location :
Scaffold_173:116796- 117857
Transcript NameFunction/comments
Hyaar_Emoy2811872myb-like DNA-binding protein, putative

Sequence
1061 bases(100 bases per row)
CATTTTTCAACTCGCGACACATTGAGCGAGCGAAAAACTTGTGAAGCCACTTCAGCTGATAGCCGGTTGGTTGTCTGTCGCTATTTCCACCACCATCAAG
TACCATTCCACTCTTGTCTGCAGTCAGTCCATTGTTGTACCGATGACTTGTTTCGGATCGAGCTCACCGTTATCGGTCACTATGCGGGAAGCGACGTCCA
TGTCGCCGACAGCAAAAGGAATTTGGTCCCAAGACGAGCACGACCGCTTTCTAGAAGCCATCAAGCTCTATCCCAAGGGACCATGGAGGACTATTGCAGA
TCACGTAGGTACCCGGTCCGTGCGACAGGTGCAAACCCACGCACAAAAGTACCAGGAGAAAGTGTCCCGTCGACTGCGGGGGCTCCGCAAGACCAAGAAA
AAACTCGTGCGTCCGGAACACCGTATTGATGAAGACACAATGGAACTCTGCAAGCTGGTGGACTGTGCTGCGGACAAACTGGTGGCAACTTGTAGCAACT
TATCGTCCAGAGCTACGGGCACCGAGCTAGAACTGTTGCCGAAGGAGGATCGGTTACAGCAAGACCTTGCTGAGACTACTGGCAGTCCGCGGGGCCCTGA
TATTCCAATCAGGACCAACGACTTTTTGCCATTGCCGTGTGTCAAAGTCGTCGACGAGATCGAGTTGGATCCAGTCCACATCCCCACCGTGAGCGAGTCA
CTTGACTTTCTGATCGAGTATCTGTCGATATAACTCTGCAGCTGAGCGCGAACTGATACCAGTGCAGTAGTGACGGAATAGATCGTCATCACTGGTAAAG
GTGGATCCGTCATCAAGCTGACTTATCGGATTTAGATTAGGAGGCTTCATATTTATGTCGTAAGGAGCATTTGCAATACAAGCTTACTCGCGGGGACTGA
GGTATGAAGCGGAACAGCTCAACCACCGAGATCGATACATGACCGGAGTCAAGCTGCCGCTTCTGATCAAACAGCCCCCACTTGACCTTTTGACTACAGC
GTTTCGATTCCAATGCCCGTGTCATTTTTGCCTGTAGTGCTGCTCGAGTGAGGTCGTCACG