Description :
From Genome Similarity Track
Location :
Scaffold_25:116780- 119082
Transcript NameFunction/comments
Phyra_71527unnamed protein product

Sequence
2302 bases(100 bases per row)
GAGCAGCTCTTTTCTCCCGAGGACCTCGCCGAACTCTTCCTCCAGCTCTGCAACGAGCAATTCCAACCTCAAATTGGTCCGCTGAGTGCACGTGTTGAAT
ATTTTACCACTCACCACCTGCCGATAGCCCTCCAAAACCAGAGCCTGATCCGAGTACTGATGCACCGTTCGGATATCAAGTTGGCAATTGGTAGTCATTC
ACAGACAATCCGCATCATCTTCCGTCGCTACTGTGCAAAGGAACGCGAGCTGATGGCACCGGTGGTTGGCGCTGCGAAACCAAAGCCTCGACATACTGCA
CACGGGATCAACAAGTACATGCGCATAATAGATTGGCAGGCTTTCATACAGGACTACCACCTGGTTCGCGCTCGTTTCTCGATGGACCAAGCTATGAACG
TGTTTCGCAACGTCCAAGAAGCCACGCCTGGAAATGACGACCAGCTTGAGTTGATCTACAGCGAGTTTTGCGAAGCGCTTGTGGGGATGGCGATGGTCTA
CTTCCCCGACCCATTCCTGAAGACTGCAACGAAGGTCACGCAGTTCCTCCGTCGATACTTACCGTTATCACCCGATGAAGCTCACGACCACGCCTAGACA
TAAACACTGTGGCGAGCTTGAATACTACCCCAATTGAAACCCCGGAACAGCTCACAGTGTCGAATACTTGCATGTTATGTTTGTTTTCCTTGGGAGAGTG
AACTGCGTGTCGTTCACTCTCTAGGCAACGCAGAAAGGAACAACTAAAAAAGAGATCGGAAACGTCGTGCTGGACGTGTCCGCACAACAGCTTCCAGAGC
GTGCACCGACGTCAGTACAACTAGCACACGCCGTGCGTTGTGAGGCCAGACTGCTGGTGCTTGAGGTTGGCCTGGAGCGAGTGCACAATGTCCTTGAAGT
GCTTCTTCTGCGCCTTGGGCGACGACATGGCCGTGTCCACCAGGATGTGGTGCTTCTCCAGCGCCTCGATGGCCTTCATGATGTCTTGCACCAGCATGTT
GGCCATGTGCGACGAGAAATTCTGCTTCACCACGACGCGCATGATCGTCAGCGCCTCGGCGCCACTGGAGCACGTGTAGGCCGGGACAATCCACCCGCGG
CTCTTGAGCTTGTCCTGGATGTCGAAGCACGTGTACCGCGACGAATCAATCAGTGCAAACGCTACGAGCGGCATGTGCTGCTTGTCCACGATACGGAAGT
GGCCCGTCGCCACCAGCGCTCCACGCAGAAGGAACGCATTCTCCATGCTAGCCTCCATGATACGGCGGTATCCATCGAATCCGAAGCGCAGCATGTTGTA
GTACTGGGCCACGACGTTGCCCGCGCCCTTGGAGAAGTTGAGTGTGAACGACGACTGGTCTCCGCCCAGATAGTTGACGTGGAACACCAGGTCGTCGGGG
AGGTCCTCGGGCTCCCGCCAGAGCGCCCAGCCCATGCCAGCGTACACGAGGCCGAACTTGTGGCCGCTCACGTTGATGCTCTTGACGTTCGGGAGACGGA
AGTCCCACTCGAGCTCGGGGCTGATGAAGGGGGCAATGAAGCCGCCGCTCGCGGCGTCCACGTGCAGCGGGATGCTCCAGCCGTTAGCCTCGTTCTCGGC
CACGAGCATGTCGTGGATGGACTTGACGTCCTCGTATTCGCCGTTGAACGTGCTGCCCAGAATGGCGCTCACGCCGATCGTGTTCTCGTCCAGGAGCGCG
CGCGCGCGCTTGGCTGTGAGCACGAGGCAGTCCGGAGACACGTCGGCCTCGCGGATCTCGATCTCAAAGTACTTGCACATCTTGTGCCAGCACACCTGCA
CGTTCGAGCCGAAGACCATGTTGGGCTTGTCGTAGGACAGGCCGGCGGCGATGCGGCGGTCCTTCCATCTGCGCTTCATGGCCAGGCCGGCCAGCATGAT
GGCCTCGGACGAGCCGATGCAGCCCGTGCCCGTGGCCTGCTGGCCGGGCTGCAGCGGCGCGTGGTACAGGTTGGCCAGCATGGTCACGCAGCGGTTGTGG
ATCTCGGCCGTCTGCGGGTACTGGTCCAGGTCGATGTAGTTCTTGCGCAGGCCCTCGATCATGAGGTCCTCGGCTTCGGGCTCCATGTACGTGGTCACGA
AGGAGGCGAGGTTCATCTTGGGGTTGCCATCCAGCGCCAGCTCGTCCTTGATGAGCTGGTGGGCCACGCGCGCGGGCACCGACCGCTGCGGGAACACGTC
GGACGGCAGGCTGGCGCACATGAGCGGGTGGCCGTACACGGCCTCCGTCTCCAGCTGCACGTCGTTGGCGTCGCCCGAGTACTTGCGCGTGCTCACTTGC
AT