Description :
From Genome Similarity Track
Location :
Scaffold_979:11675- 15188
Transcript NameFunction/comments
Phypl_g11904conserved hypothetical protein

Sequence
3513 bases(100 bases per row)
GAGaccagctgctcgaggcaGATACTGCACGAGTGCTCCGAGTGCGTGGGCAGTAACTCGTCGACATCTTCGAGGCTGAGGATGGCATTCGCATATGTAC
AattggcgtccagcacgctTGCGGGGAGCGAGAGGAAATCACGCATCAGCAGGTAGATGCACAGCACCTCGCGCCCCAGAGGAGCGGGCAGGTACGGCTC
CACGACAAGCACCGGGACGATGAACTCCAGTGCTCTCCAGCAGTCCGACAAAAAGCCTTCGAGCTCGATCGTCCCTGCATTCATGGTGTTGGCGTCTGCT
TGGATGGAGAAGGCTGCGTGCTGTAGATGCTCGTACCGCTGGAACACTTCGGCCAGGATTCGTAAGAACACCTCGAAAGGTTTCCATTCGACGACAAGAT
CCTCCTCCCCTTGCTGGATATCTGCCGGCGGGGTGAGGTGTTGCGTCACGGTTGGATGGTGCAGGATGGTATTCACTTGCGTGTAGAATCCACGAAACTT
GGTCTGGCTCATTGCGATGACCCACGCCGATTGTGTCGTGTGTCCGCCGTTGGCTGTCGTCGAGCCGTTCGTCGTCCCCGTTacgcaggtgctggtgaTG
GCCATGGAGAGCGACACCCGGTACACGACCGACATGCCCACGCAGAGCAGACGCGCTTgcacgaagaagcggaagctggaCGGCTGGAACTCCTCGCTCA
TCTTGCGTAGTCGCCGTTGCATGGGGACGCTGTTGGTGTTGGTGACGGCCGCGTGCACTAGTTTAACGCGTTTAGTCTCGCGCTCCCCTTCCATGATCTG
CTTTGTCATTGCTCCAGAGCGGGTCGAAATGCAAAATGACGACGAAAAGCGAGCGCGAGTTGAGTTTGCGTGGCGTTGAGCAGCAAACTGAACCGAAAAC
GCCGGACTCCCACAGCGACCGAGAGTTTACTCCGTGGAAGAGTGGAAACTTCCAACACTTTTGGCGCGGAGACCCCGAGCTAGGTACATCGACGCTTCTG
CTGCCGACTACAACAAGATACGCACTTGCAGCGGAAGAATGAGCAAGCCCGAAACGCTGCGAGTGCATGGCAACGGATGATTTGAGTGGTCGAGGGAAAA
CGCAAGCGGGGACAGCCTTCCCTGTTGGGTGGCGCTGTAGCACCGCTAGAGAGGGACACCTGGTTCTTATACCTCCTTGTGCTCTCTTTGGCAAATTCGA
CAAGCACGCGTTTGTAGAGAGGCAAACAGGCCGAGGAAAAAACTATCGTCGCTGCTCCATGCAGACAGATCGGCGATACTATGTTTCAAGGCGTTCATTT
GTGCTCCACATCGCCGTAGTTGCCCTGTTTCGCGTACTTGTGGACGGATGTCGCACGATTCCGGCCCCACGCCCAACGGCTCCTGCTCAGATCCCCCGTT
GTTCATTTTTGGCGAAAGTCTGATAACTCGATAGGCTCGCGCGTACGTAATGAGTTGGTAGAGCCACGTAGCGTTTCTCGAGCGGTGGAAAAGAATGCAA
GGCAAAGACGTTTTCGATAGAACGGGCCTGCGAGTGCACGACCGTGGGCAAGCCCCGCGACCAACGAATGAATATGTATCGGTGCAGAAGTCGCCGtttc
aagctgctggtgcgaAGTTCTCGTCCCCATTGCAGGCTCAGCTAGCCGAGTAACCCGATACTACTCTCCGCCCAGGGACGTCGGCAGGAACGGCACGCGT
GCGGAGAGGTCCGGCGTCGAGAGATCGCTCTTGGCTCGCTACAGTCATGCCACGCTGTAACgctccacctgcttggccaATTTCAGGCTAGGCTAGATTT
GTTTTCTGGACGTGAGTGCATGAATGATAGAGCCAAAATTTAAGCTTGCTGTGCATTTACGTGTCTAGAGTTCGGTCCTGCAGCGTGCAACTCGCTGCGC
ACAATGCGTGGTCACTGTTCGTGCCATTTGACGAACTCAGTCACCACAGAACGATAAGAGTGTGAGCATTATTATGGCAAGCTATTGCTGCATAGGAAGC
GGAAGAGGTAGAGGAAGGTAGCACCCGCAGGGACAGCTACGTGTCCGTGCCACGAATGCATCACGCGGTCATCATTACCGAAAACAAACAGCACGAGGCC
TCAGCGATCGGATACCCAGCTCCACTATGAATCACACTCCAGTTTCTTTCAAGAGTTTTCTTCAGGTGCTCAATCCTCATTGTCACAAACAGTTAACTTG
ATGAATAGCTTTGGTGGCTCGACGAGGTGAAACAGATGGACAACGTACTATGAGATCACGTCCACGGCTCGATGACCCTGCCCATCCCATCCCATTCCTC
CGGCGTATACGGAAGTTGACGCACTACGGTGGCAAGACAACTCGCGAAACGCGGTCACAATACCATACAATTGTAACGTTACCAGCAAATCCCGCACCGA
GTCGGCGAAAACATAACAAAAATCGAGGTCGTTCTTGGCGAGTTCTTTCCAGGATGTCTTGCCGTTAGGTCCTCTGATGCCTTGGTTCTGAGGAAATAAT
CGGGAAGGCAGCATCTTGAATCATAGGAAGTGcacacgtacatgtattattTGCTATTACATGTATACTGTACACCTGTCTTCTGCTTGCGCTGTGGTCA
ACCGGGCAACTTGGACAATCTTGACTCAATTTGCCATCACGTAAACGATGATAACACATGAGGTGACCGTGAAAAATCAAGCCGAACTTCCCGATGACTA
ACACTTACACTTTCAGTTGCACTTCTACAGGTCTTTCCTCTAGACTTCGGAAGTCCAAGACCCAAGAACAACACCAACGACAACAGCAATAACATGGTCT
TCACTAACTGTTACGCTAGATTAGTGTTGCTACAGCCGACGAATGGGACGCTCAAGTCGACGAGATCATGGTGAACGTCAGTACTCTCCGATTGCGGTGG
CGGTATGTTGCTGTTGTAGACATCATGGGCCAGATGACGCAGATCGTTTTCGTttttcagtgaggtacattgatgtcactcGCTAACGACTTCTTATGTC
CGTCCCACAAGTTGTCTCCACAccatcctgcagctgcgcgcaGAGTGAGACCTAATGGTCTACAACctgcgccatcgtcgtccCCTAAGGAACAGCGACT
AGGCCCTCCAAGAAGGCCTCCTCCATGTTTTGCAACCTCCATTGTCCGATGTCCCCCCTATATGTGTATTCAGCCGGCACCATCGATCCGTCTGTAGCAA
ATGTGGGTCTAGTTGCAGTTGTGTGCTCTGCTTCGTGTCCATGGCTTGATTAGCCATCAAGTCCGCCATTTCATTGTGCTCTCGTAGGTGATGTTGCCAG
GAGAGCAGTTGGATTCTCGCCAACTGCCGTCGGCACCGCCAGTAAAGAGGCTCAAGATGGGGCGCCTTCTGCGGCTTGCGCTGCGTGTGTTGCCGAATGA
TCATGGCGCTGTCCCCGGTCACATGTAATGGCGAGTATCCATACCGATTGCACGCCTGTAGTCCCACTAGGAGTCCCAAGTTTTCAGCAACAttgttcgt
cgtcgtcaggGCC