Description :
From Genome Similarity Track
Location :
Scaffold_17:116736- 117857
Transcript NameFunction/comments
Albla_Nc14021670pyruvate dehydrogenase E1 component subunit alpha p
Albla_Nc14021660pyruvate dehydrogenase E1 component subunit alpha p

Sequence
1121 bases(100 bases per row)
CTCGAAAAAGGACCTGAAAATCACGCTTACAGCTCCAAAGAGGAGCTTCTCGAGTATTATCGCTTGATGTATACGATGCGTCGCATGGAAATCACATGCG
ATAATGAATATAAGGTATGCTTTGATGCTTTTCTTGCATGGAAAGCTCAGATTGACGTGTCAATAGGCTCGAACCATCCGTGGTTTTTGCCATCTGTACG
ATGGTCAAGAAGCTGTCGCAACCGGAGTTGAGGCTGCTTTAGATCGCAAAGATGCTTGGATCACATCTTACCGTAATCATTGTACGATGCTTGCTCGTGG
AGGCACAGTGAAATCAATTCTTGGGGAACTATTCGGTACTTCGGCGGGAGCTATAAAAGGAAAAGGTGGATCTATGCACTTTTACAGTAAGAAAGAAAAT
TTCTATGGGGGTCAAGGTATTGTCGGAGCTCAAGTTCCCGTCGGCGCGGGGCTCGGCTTTGCGTGCAAGTACAATCATAATGGGGAAGGATTGATGCCAT
GTGCTATTACAATGTATGGTGATGGAGCGGCCAACCAAGGTCAGATTTGGGAAGCCGCTAACATGGCATCACTCTGGAAATTGCCGGTAATTTTCTGCAT
CGAAAATAATCAGTATGGTATGGGAACTTCAATTGCTCGCTCTTCGTCCAACAAAGACTACTATACAATGGGAAATCATATACCCGGTATTTGGTGCGAC
GGAATGGATGTTCTTGCCGTACGAGAATGCGCTCGGTTCATGAAACAATGGTGTGGCGAAGGGAACGGACCCATCTATGTAGAATTCTGCACGTATCGAT
ACCATGGTCACTCCATGTCCGACCCCGGTGTAACTTATCGTAACCGAGATGAAATCTCCCAGATGCGAGCTGCTCGTGATCCGATTGAAAGCGTGAAAAA
GCGTCTTTTGGACTACAATATGGTCACTGCTGATGAGATCAAAGCAATTGAAAAAGATGTCCGGGCCGAAGTTGTCAAAGCCGCGAAAGAAGCGAAGACT
GCGGATCGCCCTCAAGAGGGAATAGCATTTGAAAGCGTCTACTCGGACGGAAAAGGTGGGCAACAGATTCCTCCATTCATTCGATTTCCAGATTACGCCA
AAAGCCTGTACAATGGCAAAC