Description :
From Genome Similarity Track
Location :
Scaffold_946:11671- 13883
Sequence
2212 bases(100 bases per row)
ACCAGACTTGAAAAATGTGCGAACATTTGGATAAAGTCGCGTTGTTCTCATTCCAGACGACAAGAAATCGACCACTTTCAAGTTTCGACCTAAAGGGCGA
TCTGGTATTTATCTTGGGAGTGACCCTCCAAGGAAGGGCGAGTTTGTGTATGTCACCGGGCGTGGTCATCAAGTCATCCACCGCCGGATCGTTGTCTTCA
TTGAGCTACCATCTAATACCCCGAGTTAGTGCGATGACTATGAAGGTCCCATGGGCAAGGTGAGGGGCCCTGACAGCGGCGATGATCGTGATGATGACTA
CGACAATGACGATATCACATCAAAACCAACTAGACAATTTCGAAAACAACACGGTCTCCTACTAGGTACACGCCAAAAAATAGTATCTTACCAAGAAGAT
GTCGTCAGCCCCCACCGCTCCTCACGCATCGCTGAACGAACCGCAAACTTTATTATCCACGACGCTCAGCTCGTGTTGCAGGACGAGTGCTGAGTGTTGC
CGAAGCAACCCTTGATGAAATTATTCAGGCACCGCTCAACCTCCGAGAAGCACGGGCGTTAAAACATTGGCCAAGTAAGAAAAGGCTATCCAAGACGAAA
TCCAAGCCTTGCGCGACAACGATACATTCGAATTGGTTGATCTTCGTCCAGGGGATAACGTAATTGGCACGATGGTGGCCTTCCGAGTGAAAGAAAACGA
AAATGGCTCGATAGAGCGCCTGAAAGCACCGATTTACGCACAAGCGTTTCTTAAGGACTACCTCGAGACCTACGCTTCCGTGGCCCGACTGAACTCGATC
CCGTCTTGTTGGCAATTGTCACCCAACTGAAATTCCACGTGCAACAAGGCGATGTTCCGACTGCATACGTGAAGGAAAGGCTGGAGGAAGTAATTTATGT
ACGCCAACCGACTGGATTCGAGGAGGGCAGTCGCACGAAAGTATGGCGGCTCAAGAAGGCCTTGTATGGCTTAAGTCAAGCCGGATATGAGTGGAACCCA
GCACTCAATGTGTTCCTCGTGCAGTGTGGTTGGTCCCAATGAGTGAAGACCGCTGCCTCTACACACACCCAAAACATGTATACATTGTACTAATTTATGT
TGCCAACGTTCTCATAGGTTATCGAGATGAAGCTGTCATGCAGCATTGAATGAATGAATCGCAAGCTAAATATCGTATCAAGGATCTCGGGGAAGCAAGG
TGGTTCCTGAGAATTGCCATTAATTTGGACCATACACTCGGCATCACGACGCTTAACGAAGCCAAATTCGCCGCTGAAGACACAAAACGCTTTAGAATGA
ACGCCTGCTGGTCACGAAGGCTGCCAATGGACAAGGGGCGATATTGTACAGTCGAGCCGAAGATGTAAATGCTGCTTGAGATGTGCTCAATCAACAACCT
GTAAGTGCATTTCTGTACTTGGCTCGGGGTCTCGTTCTGACATATCTTATGCAGTAAACCAAGTTGCCGCGCGTGTCTCAGATCCGTCCAAAGCTCACTG
AAACGCAGTGAAAAACATACTTTTCGCTATATCGACGTGACCAAAACCACGGAACCACATGTGCGACTATATACTGAAGCAGACTGGGCGAATAACGAAA
GGGATCTCCGAACCAACTCTGGTGCTGTAGTCCAAGTTTTAGGAAGTGCAATCGCTTGGCAAACCAAACGCCAAAACGTTGTATCGAAGTTATCTACAAT
TGCCGAGTACAtcgctggtgatgatggcGTGGGGGAAGCAAGGTGGGCAATGCTTTACGTCACACAACTCATGAAACTCGACAAAACCATCAAGATTCCA
GCCATGGCCGACAATAAATCAACGGCCAACCGACTCACAAATGAGCAAAGCTCGGATGCACAGAAACCCGTGGATTGCAAGTTCTTCTCGATTCCAGATG
CAGACGACAGCGGAGAACTATAGCTGACATACTGCCATGTAAGCTGACACGCTAACCAAGTCACTACCAATGCCGCGCTTTCGGAGAACGCGGGAAGGAC
TAGGCGTGGCGTCACTATCGTACACGTCCAGCGTTGGCGGGGTACTGTTAGATCAACCAGCTTGaacctgtacatgtacggaTTGATGGTACATATGTGA
TTAAGGTTCATGACTCCGACTGAGCCAAGTAGACAGACTGAGACTAGTAGCGCCGAGGAAGGTTTAGTCTTTAACTAGCTGATATCGAATCACTTCCAGA
TTTACTCAAACA