Description :
From Genome Similarity Track
Location :
scaffold_677:1167- 2540
Transcript NameFunction/comments
Pl_103021pectin methylesterase

Sequence
1373 bases(100 bases per row)
ATGGCATCCCCGGTGTTTTGGTACGATGTGGAAGGACCACAGCGGGTCATTAATCAGCTAACTTTGTGTTTTTCTTCGCATCACTCAAACCAACTCGACC
GACAATGCGCGTTTTCGTCATTCCTCTTGTGATTCTTGCTAGTTTCGTGTCAAGCACAGTCGGCTATGCATGCACTGGGCCCGACACACGGACCGTGCCC
CCAGCCGGAGCAACCGTCGTCGATGCTAGTGGCGCATACGCTGGCAGCTTCCGCAACATTTCGGAGGCTGTGGCACACCTACCCAACACGACGGAACAGC
ACACGTTTTTCCTGTTCCCAGGTGTCTACCGTGAGCAAGTGCTTATCTCGAAATTGAACGGTCCTCTCGTGTTGCAGGGCTACACATGCAACACGACGTC
GTACGCTGCAAACGAAGTGACAATCACCCATGCTAAGGCACAGAGAGACATTCCTCCGGAAATCACCAGTGGCCGCAACGACTTGACCAGCACACTGCGT
CTCAAGACCAACAACGTCCGAGTATACAATCTCAACGTCGCCAACACGGCAGGTAAAATCGATAAGGACGGTCAGGCTGTTGCCACTATTATCGAAGGCA
ACAACTACGGCTTTTACGCCTGCAACTTTACTGGGTATCAAGACACAGTGTACGCCAACAAGGGACGTGAACTCTTTGCCAAGTCGTACATCGCAGGCGC
CGTTGATTTCGTTTTTGGATCCAAGGCTGAAGCGTGGTTCGAATCCTGCGATTTCGAGACTGTCGGTGAGGGTTGCATTACTGCAAACGGCCGTGTGAAC
GAATCCAGTCCGTCCTACTACGTTTTCAACAACGCCCGTGTGTTTGGCTCGAGTGGTAACGGATCAGCCTACCTTGGTCGCCCGTGGCGTCCCTACTCGC
GTGTTGTCTGGCAAAACAGCGAGCTCGGCGATGTTATTAACCCCGAAGGTTGGCAGCAGTGGAACAAGGACAACAACACGGCCAATGTCTACTATAAAGA
ATTCAACAATCGTGGTCCTGGTGCAGCTACCGATAAGCGCGTGTCCTTCAGTGGACAACTCAGCGCTCCTGTGGACATCAAGGAAATCCTCGGTGGAAAC
TACACGAACGAGTGGTTTGTTGACACCACTTACCTTTAGACATTTTAGATCACTGGGAAATCCCAGATAGAAACTTGAGTTTACAAACAAAATAATCGGA
TGTTTCATGATACTACGTGCTGTAGTACGTTTACAAAACTGTTTATATGAACATTTCCGTACTAGTTCTAGTTTGGATACGTGCAATATCAGCAAAAGTG
ACTTTGGAAATTGTGGATATATCGATGGCTAGTTTTACTACCATTCCTTCGTTGAAGGATAAATCTACTGGAT