Description :
From Genome Similarity Track
Location :
Scaffold_2:116650- 120608
Transcript NameFunction/comments
Phypl_g86hypothetical protein PHYSODRAFT_490644
Phypl_g87hypothetical protein
Phypl_g88hypothetical protein
Phypl_g89glutamate-rich WD repeat-containing protein

Sequence
3958 bases(100 bases per row)
caccagcgtcaTCTCGCCAAGCACGCTGAGCTCGACCGTGACCATGTACTGATTGCGCCTCTCTCTCTGCAGGGCTCTCTGGATGATGCTgcccgccagc
gccgacagcacgGCGCCCAGCAGTGCCTGGTACATCCCCGTGAAGACTACGGCGTCTGCCAGCTCCGTGTCCCcctgctctgcgtcgtccgcctccgtcg
acgacgcggtcatcagcaccgccgccacgcagagcagcgccagcgccaggagctgcagcggggACTGGCGCGTGCCCAGCAGGAGgtacacgagcagcgc
cgtccaGATGATCTTGGTCTGGTTCAGCACGTTGAAcgtgacgccgtccagcgccaccaccgccgcgtgGTTCAGCAGGTTCTGCAGCACATAGATGAGC
GCGGGCAGCACCGTcgtggccacggcggcgcgcagccTCCACGTCTTGAGCTGGTTCAGCAGACCGGCCTCCCCGCGCGTCAGGctgagcggcaccagcg
ccagcagcagcttcaggaaCTCCACGACCCCCACGCGCAGACGCACGTCGCGCGCCTCGCTCGCGTACCAGCCCatgagcagcggctgcacgccgacctg
cagcgccaggagcagcagcaacgtcgccTGTCgggccgaggacgccgccatgTCGAGGGGATGAATGGAATGGCGCGTATACACGCGGTGATTTGCATGT
ATACTATCGGATAGCGTATACAGATGGTGGGATGGATACTCGATGATGGCAcgcttggtggtggccaggcagcgagcagcagtttGGCGCCGGCGCCCTA
TCTCGCGCTAAACTTGTCGGGCAGGAATAGATACATACGAGTCGGCTGTGTTGCTAACAGTTTGTAGCAGTAGCCAACCAGTGCCACGCACTTGGTAACC
ATTGCCGAAGGTCTCTCTGCCTTGGAGTTTCAGTGGTCTCAGCATTTAACTTAAAAGTGCAATACCAACTCGACATTAACTACAGTATCAATCAACAATA
AACACTAATCGTTGCGGAGGTATtagatacatgtagtgcatGACGCGCGGGGCCATTAGCTGCGGCAGGCAAAGTGAAGCGACAAACTCACAGTGCGTGA
TTGACAAGTGAACTGTATTTGGACCGACTACCCCGCGTTCATTGGTCAATCGAGGCTGCACGGATTACCGGTAAAGTCGCGGCGTTGCGGCTGGCATCCT
CCAGGAAAcgcagccagcgccttgaCCCCATCCCAAGAGCTCCCGGTGATTGTGCCCCGCATTTCCGTGTTGTATTCTGCAATTGCACTCTTCGTTGTGA
TGTCGTCGAGGCTGCagagcgtggcggcgctgctgttcgtctGCGTATCCTGGAGAGCTCCTCGAGTTGCCGCGAATGAGTCCGCCAGTAGCGCCAAGCT
CCTGCAAGGACCAAGTGCAGGGCCAGTTAGTCCGTTGGGCGTAGATGCTTGgagcgccggcagcgtcgcGGCTGGCTGCTCCCTGTGTCGAGACAGCGGC
AACTGCTCCGTCGCGATGAAAGACACCTCGTCCGGAGTGTTTTGTGGTGACCTGCACGCTGCGGCAAACACGCAGCCGTGTTGCTGTCCGTACTACACAG
AGTGCCAAGTAACCAGCAAGTCCAAGACGTGCAAGTGCAGCGGACCGTGGCCGATAACCACTCGCCACGAAAGACTCTCAGTTACAGAACCAGCGAACGA
AGCAGAGACCCTAGTCCAGGACAGCTTCACGCCGGAGACCGACGACGCGATGGACAACCAAATGGCCGTCTCCACGGAGATCCTGATTCACTTGTCGGCG
TATCTTGCGCTGTTTGTCTTCGCAGTGTACGTGGATCAGTGGGTGGAGTGCTTCAGCGACTTCAGGCGGAACCAAATGGTCGTGTACGGCGAGGCTGTCG
ACATGAAGTTGCTGCGTTTCCGCCAGCGCTTCGgcaagcggcggcgagaCTCTCAAACGGACACTGAGACCGACGACAatctgccgctgctggtgttgga
atctccagcaccaaccTCTAGACCTGTTTTCACATTTGAAGAAATCCCCGACACTGAAGAAGACACTCCCGTGGTCctcgaggtggaggagaaaACGTCC
GTATCCGAAGAGGTTGTCGTTGTCACTGTTCCTGTGGTGGTTGTCCAAGAAGTGTGTACCAGTCCGCCGGCGTCCCCGGTAGAGCTAGAAGAAATTCCGA
TAGAGTAAAGTTTTCCGTCGCAGTCAAGTGTGTATCATAATATCAAACTTACATTCACCAGTAACCCCGAAAAGATTCGCCACTTCCTCTTCTTAAAACT
TCAAGAGACGGCGAAGACACGCATAAGCAATTATACGGTTTGGAGCGAAGTTGAACCGCCTTCTTGCCTCTCGGCGGTAGTCTGGATCTCGTCAACTGAG
TCGAccgccacttcaacatcagcCTGCGAAGACGACTGAGGTCGCAGTGGAGctgtgtcgtcgtccacttcagcttcttcctctgctACCGCAACCGCCA
CCgcagtgacagcagcagcccctATTGTGGCACTAGCCGTCTGCTCCGTCGCtctctcctcgtcctccgagtcgctgtcgactGTATCCACGACACTGTC
TTCCCCTCTCGCCCTCGCCGCCGTGAGGGAACTGGCCAGTAGCTGGTGGCTGCTGTTCATGACCTTGTAGGGTCCGGCGCACATCTTGTCGtaggccagc
agcgcccagGCGGCGAGCGAGAGACCGACAAACAGGTAGAACCTAGTGGTCATGATCTCCTCCTCTCTGGCCCCGTCGAAGCACTCGCACGAGTCCAAGA
AGATGGTGGTCATGCACTCGTTGCggaacgagcagcagcacggctgGAACGTGCTCAGCACGTCGCCGCAGAACACGCCCTGCGATTGGTTGTGCACGGC
TACCGAGCAGTTCTCCCCGTTGCGGCACTTGGCGCAGCCCCGGTCCGCGGGCGCGTAGAACTCCATGCCCATGCCGCTCGGGTGCCGCATGTGGTCCGCG
CCGCCGTAACCGAACAGCGGCTCGGCCTGCGCGAGgctgacgagcagcagcagagcgaggcTGAAGCTGTGAGCGAGCGCCATGCTGGAGGTACTTAGCC
GATTTGGTAGTCGCCGGAATACGGAATGCGGAATGAGGAAGGGCCAGATAACAAACAAATACAGTACTCATAATTAAAACAACATTAAATCATTACTTTG
TATACATAAACACTATACTGCATTTATACTGTCCTAGGATCTCCACCACCGAGGAATGCCGCAGGACGAGCGGCATCTAAGGACGAAGACACCATCTCGG
ACATGAAGAGTCTATTGGGCTTGACACAAACGCAAGCGCAGATCTTATTTACGAAATATTAGCAGGCTTGAAGACGTTGAAGCCGTCACCAGCCGTGCTC
ATGAGCACACCCGGGCACTGCGGGTGGAagtgcagctccttgatgtcGGTCTGGCCCTGGTGGATGaacagcagctgcggcggcagGTCAACCTTCGCCT
CGCCGTTTTCGCCCTGGACGGGCACAGCGGCCTCGGCATCCTCTTCAACAGACATATCCCAGACCGAGATCTGGTTGTCGACGCCTGCCACAGCCAGCAC
GGACTCGTCGGTCGGGTGCCACTCGATCGACGTGACCGGCGCTGTGTGGTAACGGAAGTGCGCCACCGGGTTGTCGGCCTTAAAGTTACGAAGGTCCCAA
ATCTTGAACGAGCCGTCGTCCGAGCCGGACGCGAGCAGGTAGGCGACGTTGCGGTTCCACGAGATCACGTTtacgtcgtcgtcgtgagcagcaacGTCCA
GCATGCTGCCGGCCTTCCGCCGGGTGTCCCAAATGCGCACAGTGCGGTCCGACGAGCATGAAGCGAACACCGACGCCTCCGTGGGGCTCCACTGCAGGTC
CTCGACCGAGCTCTTGTGGCCCGTGAAGGGCACCTTGTCGACGCTCCACGCACCCTCC