Description :
From Genome Similarity Track
Location :
Scaffold_831:11663- 13189
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap_masked-piw_contig_831-abinit-gene-0.10RhoGAP domain-containing protein
Pytiw_DAOMBR242034maker-piw_contig_831-snap-gene-0.9Conserved gene of unknown function

Sequence
1526 bases(100 bases per row)
ATCAGTTTCCCGTTCAAGACACGGCAGGAAGTCCACATCACGTACAATGTGAAGCACGCGAGGTACGAGGGACTCCCGGCGGCGTGGCGAGTGCTCAACC
ACCAGTTTGGATTGCCGCTGGAGGCTGTGCCGAAGCGCACAGTCGATGGCTACGAGGCCAAGATCCCCGCTGTGCTCCAGATGATGAAGGAGTACTTGCT
GGTGAACAACGGCACCACACTGGAGGGGATCTTCCGCCTCGCCCCAGATAAAGATCAGTGCAGCGCTGTCAAAGAGGCGATCAACAATGGCACGTTCAGC
GGATGCTCGGACGTCCACATCATCGCCAACCTGATCAAGGTCCGTCGAGCGACCCTGTGGTTCTATTGGAGCTATTGGAATCTCTCAACTGACCACGCTG
TTGTGCTTTCTAGGTCTGGTTTCGCGAGATCCCGCAGAGTCTGTTCAACATTGTCCCTGTGAAGCACATCTACGCCGTGTGCGCGCTAAAGGTCCGTGAC
ATGTTGGTAGAACTCCATCAAATGTTTATAAAAGCCTACAGGGGCTCAGACTGATGATCGTCTCTAAATTACAGGACCCGCAGCAAATTCTGGACAAACT
CGACGACTTCCCGGTGCTCTACAAGAGCGTGCTGCTGTGGTTGCTCGACCTCATGGCGGAGGTGGTGCAGAACCAGGAGGCGAACAAGATGACCGCTCGA
AACATGGGTACGCAATAACGTCTTGTGGATAGAGGATGACACTGAGCTCTGGGCTGACTAAAGCACTGTTTGTTTCGTAGCGATCGTGATGTCGCCCAAC
CTATTCAGCATCTCGACCGACAACCCAATGTACGCGCTGACCATGTCCCAGAAGGTGGCCGACTACACGTTCGCGCTGCTCAGTGCGCGGCTCAAGCTCG
CATACCCGCAGGTTCAGTAAGACGGGTGAGGATGGTGAGAAATGGGAAATGCGAACAATGGTTATGCTACATGGTTTGTTGTATTGTCAAATAACTTATG
GACAGGTAAAGAAGAGATGCAAGGCACACAGGACGAAGCCCCACGTGGAGGGAGGTCGTCGTAGAAATACAAAAGCTGGGATGATGAAGACCTAGAGAGA
GGAGAGAGCCGGCCCATGAGGAGGAGAGACTCGTTTTTTTTCAGACCAGACAGCCAAAGCTCGGGGAGATCTGTAGGAACACGTCGTCCTCGAGACCCTC
TGCTTCGAGGTGCTGCTGACGCTGGTGCTGGTGCTGCTGAGGCTGAGGCTGCTGGTGAGTCTGCTGAAGCTCACTGTCGTCGTTCAACAGGCGCGCTCGT
CGTGAAGCAGCCGCCATGGTGGGCGACCGCAACATCGGGAAGAAGTCGTCGTCGTGGATCGAGGAGATCCCGTCGAGCGCATAGCCGCACGTCGGGTGGT
CGTCGTCACCAAAGTCCTCCATCGTGAGGCTGTACTCACCGCCCTTGAAGTCGCTGAAGAACGGGTCGTAGGCATCGAATGGGATCCCCGAGCTCGTGTG
CGTCGAGTGCGCGGCGAAGCGCACCG