Description :
From Genome Similarity Track
Location :
scaffold_6:116629- 124117
Sequence
7488 bases(100 bases per row)
GCAGGAGCGAATGGCACACATCCGGCGATCTCTCCGACGATCCGGATGTCGGTAAAGTGTCGGTAGGAGTGGCAGCTGCGCAATCTGGAGAAGAATCTCC
TGCCGACATGTCGCTACCTACATGCACATTCGCTCCAAAACTGGAAAGCGTGATCAGCGTGATTCCCTTTCCGGCACGGGGCGAAATTTCCGACCCGCGC
AGACCAACCAGCCCAAACCTGGAAACCAGTGCCGTGACGGTGTCGGGAACGATAAGTTTACTTTCTGTTACATCTACTGTACACAGAATCCCGGGCTTCT
ACCCGGCGACATGAATAGTGAAAACGAATCCGCTGCAATGCTTGCTATTCACGACAACAGTAGCGAATGCCATCGCTCAAATGCTACGGTAGCAATGTTT
GCCAGTGATCCAACAAGTACCTACCGGTATGGCAATAGCTGCCGAACAGCGAGTATCCGCCACCAATGCCACCAATTTTCAATTTGCGGTGCCCGGCACA
CGCTCTACGGTCTGCCGCGAGCCTTTGCGGCCATTTGACCGACAGATATCTTCGCGATGGGAACGCACCAGTACATCACGTACTAGTAGTAGTACGGTAC
TACATGTACATGTAAGCTTACTGGTGCGTTCCTGTACATGTGCACGTACACGTACTGCATCCGATGAGTGCGCGATGTTTCAGCTGATGGATATCCTGGC
AGGCTCCTGCATCGATAAGACAAAAGCTGTCCTGTGAAAAACTGCTTTACTTTTGTAAACGCGAGGATTCGTCAGTCATGCCAGAGGCGACAAGAACGGC
GACGCTGGTCGTCACAGCGGCATCGAGACTTCATGATCAACTATCTACAGTATCATACAGTTCGGTAGTTAGCGGCTGGCAGTCACAGCGAGCAGGCCAG
TGGGAATTTGGTTGTGGCGTATGGGCAGAAACCTTGAGACACGTGTACATGTACACGTACTACATGGTGTAATGTTATTATTCTTTGCGTGTCAAGTGAT
AACGCGACGAAAATGGACCATTTCCAGGTGATCTGAAGATCTTTGACTTTTTCAAAACTTTTGAAAAAAACTGATCAAGATTCGTTTCCAGCCAATCACA
AGCTACCTACGTTTTTCGATGAGCGTCCACCTACACATCGGGCAATGCGGCAACCAGTTGGGCGCTGCGTACTGGCGGCTGGCGGCTGCTACTGGTGAAA
ATCAAGAAGATAGTCATAAACGAGGTGACGTGGGTGTATCTAGACACACTCGTCGTGCGTCTGGAGGTCCCAGCGCCGCTATAAACGACTCGAAGAAGTG
CGCAGCATTGTCCAGACATTTGTTCCACCCGTCGAGTGGGGCTGCTCGCTGTATCCTCGTGGATTCGGAGCCTAAAGTGATTCAGTCCGTATGTGAAGCT
GATACTGATAGTGCTGCAGCTTTTCACCCTGCTCATAAGCACGTGGAACAGGCGGGACGAGGCAATAATTGGGCCATGGGATACTACGGACCGAGACGGA
AAGCTCCGGCGCCGGCCTTCGCGTCGCTGGGTGTAGATGAACACAGAGAGCTAGTGGAGCTGGTCATGGACTCAATACGCCGGGAGATTGAAAGTGTGGA
CTGCTATCAAGGCAGTGTGGTGATGCATTCTTTGGGTGGAGGAACAGGATCAGGATTGGGGTGTCAAGTGCTGGAAACAATTAGAGACACGTACCCAAAG
GCGTATATTGTGACTGCTTCAGTAGCACCGTCCTGCACTCGTGGGGATACCCCTCTTCAGAATTATAACGCGGTGTTGACGCTGCGATGTCTGCAAGAAG
TTGCGGATGCGGCTATTTACAAGGATAACGACGAGTTGCTCCGAACGGCGGGATACTGGAAATCCCTAGTTCAGGAGAGAGCACGAACTGACTCTACGAA
TCAACGCGTGTCGCTGGATGAAATCAACAGTATGGTGGCTGCGGATCTGGCGGGGTTGTTGTTTCCTGTAGCTACGGGGGAGGCTAGTACTGCTCGGTCC
TTCGATTTCGGCAAGTTGCTGCATGATGTATGCCCCATGCCAGCATTCAAGATGCTTGACGTTCGTTCGGGGGTGTGGAGAGGCCGTGCTGGGTCAGGTG
TACGCAGAAAGTGTCCTTCAAAGACGTCTATAGCGAAAGGGGTCTCATCAGCAGCCCTTTTTCATGCTCCGGTGGTAGCTGAATCGCGCTCGTTATCTCT
TCGACGTAACCAAGCTGCTGACTTTGATACGTCCCTCGAAATACTTGAAAAGCTTGTGCAGCAAACAAGTGGTTCTTTCCCGCGTACTTCGAGCACAGTG
ATGGCATCAAGTACTATAGTCCGTGGTTTCATTCCAGCGGCCAGCGAAAGTAGCCTCTTTTCAGAAAAGATTGGTGGGATCGTTCAGACTGCATTTCCCC
CAGTGCCATGGCTAACAACAATGCCGCAAGCCGCGCTCACCTACTCGAGGTCTGAGCCATTTCCAGCATTGCAAGGGAAAGCTTCCGCAACGATCTGCGT
GAACAATGGTAACTTTCTGGCCAGCACGAAACGCTTCTTGGAACGAGCCCAACGTCAATTCCACGCCGGCGCCTACGTCCACTGGTACAAACAACATGGA
ATGGAGGATGCTGATTTTCAGAATGCTTTTGCCGAATGCATTACGCTCATAAACGAATATGAAGTCCTGCAACGGTGACTCGGAACGCTGGGATTTGTTT
AGTTTTATGATAAAAACTTTTATCCCCGTAAAGCACTTCTCAACTGCTGAATCTCCGTTGTTAGAGACCGAATACGCTCTTTTGTATGAAGCCATTGCTT
CGTGCGAACCGTATGCTGTTCCTCCATTACTCGAAGTTTAAGCGTTAGCTGGGGGTCCATTTCCACTTGTTCACGCAAGACCTCAAGTTGTTGCTGAGAG
ACCTTCCATTCCTTTTTCCGTTGGCTCAAGGCTACAATTTGCCGCTCCAATATATCCAACTGCTGAGCTGTAGTATTTGGTAGCAGCAGGTCCACATCTT
CTCGGACAGGCAGCATGGAGGTAGTGGTGACCTCTGGATGTTTGCAGTGCACTCTTGTGTGTATTCTTGCGCAAGAAGATTTCTTCGTCGGAGAACTGGG
TGGCTCGAACGACGATGGACTTGATGGAGCGAATGGTACTGCTGGAAACTCGAAGCCACAGCGTAATGCTTCGTTCTTCATGTTTGTATTCTCGTTTGGC
AGCCGAAGATTTTCCGTTTCTGCTTGCGAGAACAGCAGAACATCGACAGGTCTTCGAGGCTGCGGGCGATTTCTCGGAATTAATACGAACTCTGACAAAC
GAGACCTCTCGTCTGTCCAACTCGAGCCTCCAGCATCATCCAAAAAAGGTTCTCGGAACTTCTTTCCATTTGAAGGAGGAGGCACTACGTGTTCCAACTG
CCAAGACCAGTCTTCTTGAACGGGTCGTGGCCCCTTTCTCGATACAGTTTGTGCTTCTTTCCTGAGAGTTCGACGTCGAGCTGCGAGGTATCGCCAGTGT
CTAGCTATGGCAGCAACCCTGCGCCAAACTTGTGCCGTGTTGCTCGCCTGGGTACGTGCAACTTGCTGTTCACGCTGCTCCTGGAGATGCAGAGCAGCGG
TCATCCAATGCCGTAAGCCATCGCGCACAAACTGCTCGTGACGAAACTCGAGGGCTTCATGGATGCGTTGTTGCTTGGTCCTTTTACAATTCAAGTACTG
TTTCCATCCATCGAATGCCTTGCGCTCCAGCGTCAACTTCCAATGCACCAGAGCTACTCGAACCTTGTTGCGGTAACGCTGACGCAGAGCTACGTTGTAG
TGCCATCGTTCGAAGCATTTCCTCCAAAGTACAGATTTGTAGTGCTCTTCCGCACGAGCTTGCGTGATTTGTTGCCATCGTAGAACCGAAACAAACGTAA
CCCAACGCGAAAAAGACGTCTGCAGATTTCGTTGCTGTGCTTGACCCCTTACCTGAGCGTTTACGACTCTCTTGGCGGCTCTAGCGCGAACAAACTCTGA
CCAGTTTTCGACCACTCGCGCTTGAATACCTTGATCTTTCACTACTAAATGTTCTCCCAGCGCCTTTTCCAAAACTTGATTCCGACTACGTTCAGCCTTC
CACAATGCTTTCCACATATGAAAGCTTCGCCTAACTATCCGTAGATAATTGTGTTCCTGCGCAGTCGCCAGCATCTTCTTCTTTGACAATGCTATTGTAT
TGAAGCAGCGGAATCCCTTGGACCACACACGTTCCAGCAATTGCGATTCGTAGTGACGTACTGCGCGTTCCGACTTGTGAGCTTGCAATTTCCGTTCGCT
CGTGAAATGGTCCCATCGTGAAAAGGCTAACGCCATCGTTCTATGATCTGCTGCGTCCTGCAAATTCTCCACGCGATCTAACGCAAGACGGCGCTGTGCG
AGCCCCGCTTGAAACCCACCAAATCCTTTACGTAGCAGTGATATGTAGTGATGACGCACAGCGCGACGTCTTTGCTGCTCCCGCAGTTGCTTTTCTCTCG
TCTGAGTGCTCCACACATCCCATATTCGTCGCAATCTACGTTCCTGATATCCTTGAGTAAAGCGTTCAACTTTGGCAAGTTGGCGCACTGTTGTTTTCCA
TGTTTTCCACGCTCTTTCACAAACTTTCCAATACAAATGGCGGTCGAGGAGATGTACAAGTGCCTTTCGTCCCAGAATTCGGCCGTGCTGTTTCTCCCAT
AAATCAAACGTGAACCGGAGCAAGCGGCGGTGTGTCATATGCGTCAACGTTTCAGCTATAGGTCGGTAAAGTAGCGCCTCATGGCGTCTTCCTCGAACGT
AACCCCGCCACAAACGCAGCGTTTGGTGCAATCGTAACCGCAACCTCCACTGCTGCATTGCTTGCACCATCAAACGCTGCCTATTCGCTGTCCCAACCTT
GACTGTCAGCGTACGCTCTTTCTTCTTGAGCAGTGCGTATCGACTAAGTTGACTCAATGACCGCTTGAGCAGCCAGTAGTACAAGAAAAAATAGGCTCGT
TGTTGCTGGACATCACGATCCTTTTTCAACCGTACAAACCCTCTCCAGCGTCGAATGGCATGCAGGAAGCGGATCCGTACAACCGCAGCGTCGTGTTCGA
TGACACCAGGCTGTTTCTTAAGCGCAAGCCCCCCTTGCTGGACAAGAAACAACATGCATTCAGTTAGCCATAAGAAAAACTTCAACTACAATAGTGACTG
CGTTTTTTACGTTCGAGATATGCCTCTTCCTCACCGAGATTGAAGCAATTTCATCGTAGCTTGCATCTAGTGAGTTCTCTTCTCTGCTGTCTCTGACATT
GTCAGTGCCATTGACAGTGGTCGCTTCTTGTCGTTTTTGTGCTACAAAAGCTCTCCATTTCTCCCAAAAAATCCGCTGGTAAAACACAGTACCCACTCTA
CAAGCTGCGGCGACGCGCTACGTAAAAGAACGGGGAACACACGTTAAATTAATTGGATCAAGTGATACCCGACACTAAATTCGTACTTTTCTCCGCACAC
ACTGCACCTGAGCGCGTCGTTTCCACGCCTTAAATACACGTGAGAGCTGTTTGTGTCGGTCGTGATGGACAGCCAGCACCAGGTGCGCGGATGAAGGCGC
TATGGGGATTTCTAGGCACCCATTCCCGGCCGCGCCTTCAAACAACGCCATTCCGATCGTGCTGTTCCAGGATTGGCTGAAATTACGATTCTGTGGAACG
ACAGCATTTCCAGTATTAGTGATCCGCAATAATGTGCGAATGCTGGATCGATGGCGAACTGCGCTGTAAGGTTATCGATGTCGTTCTGCTACAGGCAAAG
GAGAACCTTGGCGCGCCAACAATACCGGTAGCTTTATCAGTTGTGGAAGGCTGCGCTATTTTAATAGCCGTACAGAAGTTCTTGTCCTGTTCTGGTTACT
CCGTCAAGCACGCGAGCATTCCAGCAAAGCCGTGGTAAGGCCAGCAATTGATGTCATGCGAGCCGTCGAATCTAGACAAGCAAGAACGCAGTCAAGACGT
CCCAGTGACCGCTTTCATACCCACGAGGAAGCCATACAAGAATTCCGAGCAGAGACCTCAAAGCCGACCACAGCAACCAGACCATCATCTGCCTTGAAAT
CCACGGGTCACCGTTTGATTCATGAAGATCTGGTCTCAACCGAACCGAATGAACCGCGGGAGGTTTCCCCTAGGGACACAACTAGGACACCCCCAGCTCG
GCCCAGCGGTGGCTTTCAAGCACGCGATAATGAAATGATGATAATCAACGACGAGCTCTCAACGATGACTAACAGAATGAGCAACCCAGCACTACCCTCG
CAGCAGGTTAGCACTCGCCAACCTCAAGACGCCGGGTCGTTCACAAACAAACTGGAGTCGCCATCGAGATATGCCAGTGGGTCCAGTAGGCTATCGTCAG
CTGCCAAACGTAGCGGGCGTCTCCAAATTCACGATGGCGGGATATCTACCAGCACACAAGAGATCCTGGCTGTAACACCGCGCAAAAGTTGGCCTTCTTC
TCCAGTCGAGGAGACGAATGATAATCTCCGTGTTCACAGCAATGAGATACCAGCTCCCAAGCCTGCATTACCACCGAGAATTGTTCCGCTTTCGCCCATT
CGACAGCTTAGCGAACGCATCAAAGTACATGATGACGGCGCGCTTCCTGTCAGAGCAGAGGCCTCCCCAAAGGGGGCGATCCCAGTGTTACCAATTCGGC
AGCTAAGTACTCGATTACAGGTTAATGGCGATGGAACAATCACGAGCAGGAGGGATTCCTCCGTTATCAAGCCGATAGTGGCTGTGGTGCTGCCCCTTGA
TGTGATAGATACCAGGGAATCGACGGATCAAATTGCTAAGCAGCCTCTGGATCGTCAACTTGATGAAAATCTTCGCACTGAAAGCAACTATAAACCTGGC
TCCGCTATCCCTGACGTTTCATCGTCGTCAGCTGCAGAACCAGAACCTCATACTCCCATTTCGCGATTCGCACCACTACACAGTCAATGGACCTACGGTC
AGCGCGTTTTTGGCCGATACAAGAAGACGCCGTACTTTTATTCGGGAAATATTGCCACATATCTTGGCGCAGGGATGTTCATGGTCGTATTTGATGATGG
AACATTAGATTATCGTGTTCGTCGGGAAGACATTATGCTGCGAGAGCACAGAAAACATCGTCAAGATCAAGACGATTCTTCACAGAGGAGTGACAGCGGA
TCGTTTCGCCGCGACAGCTTTGGTAGAGTGAAGGCAGAGAATGACAGTAGCTCAATGTCCCGAAGGAAGTCGCAGCAAAAGTTAGGTGAGGAGAATGGAG
ATCAATGCCTAGACCCGTCGGTGGCACCGGAGATGCATCTGCCACCCTTGCAGCACGTGATGGTGGACTTCTCCGTTACCCCACCAAAAGAAATAGTGCT
GAGCTTCGACGACAGCGGAGTCGCTTACGAGGTTGGACTACCTGCTTGCGGCGCCACACAGGCGGAGAATGAGACCTGGCGCCTTCTC