Description :
From Genome Similarity Track
Location :
Scaffold_2:1166068- 1172426
Transcript NameFunction/comments
Physo_127703hypothetical protein
Physo_127704hypothetical protein

Sequence
6358 bases(100 bases per row)
ACGCCACGAACGGGACGTTGGTCAGCTATCTAAAGAAACACCCCGACGAGGTCTGGTCGAAATTGTATGAAGCTGCCCTAGGCGTTCAGTACCTTCATGC
GCGCGGTGTCGTTCACGGGGACCTTAAAGGGAATAATATTGTGATCGGGAGCGATCGGAAGGCCAAGGTGACGGACTTTGGTCTGAGCGCGATGACCAAC
GACGGCGCGGATTCAAAAATCTCTGGTGCTTCGCACTGGGTGGCCCCGGAGTGCTTCATTCATGAGCGTGCACGCCCAACCTTTGCGTCCGACATTTACT
CTCTCGGTATGTGCGTTGTGGAGGCTCTGCGGGTCGTCGAGGCCGGCGAAGACAACACGAAAGCTTGCCTACCATGGGGTTTTCTCGACAACTTCGTCGC
GAAATATCACGTAACGCAACGTGCATTGCCTCCAAGACCACTTTGTACGGACGAGCAATGGGAGCTGGTGCAGCGAATGTGCGCTTTCGAGCCGAGCAAA
CGGATCAAGATTTCGACTGTGGTAGGCGAACTGGCAAAAATGGCCAATATTCACCTCTCGGCTAACATGTCGATTGAGCCTGTGAATCCTAAATCTGTTG
CAGAAATGATCACTGCGGCCCGGACTCTGTTAGCCAAACTACAAGACGACAAGGAACAAGAAGGATCCGTGTTCTCCTTGTACAGCTCCCTGTGGGATGG
GCTCGCCCAGGTACACAACCAGTGTGGAAATTTGCAAAGTTCTACAGATCTCGCGGATTTTTACTCCCTCGTTCGTGAAGCGTACGAGGGCACGAAAATG
TTGCGAGACCCAACGACAAGTCTGATATCACTGGCGGAGACTGTGCTGCAGTGCTACGCGTTGCAACGTCGGTTGATTAAGCTGTTGGAAGCAAACTTCC
TCCCGCTGCGCGGTCAAGACAGTGCAGCAAGTTCCGATTCCAAATGAGATGCAGTCATCTACAAAGAGAAAATCTTTGGCGGGCCAAACTTGTAGAGATA
CCCCGGACGTACACTTCGATCCACCGTCTTGAGTAGTGTCGCTATCTTTCGACGACTTGGCTTCGTTTGGTTAGTATTTGGCGAGCCGGCGAATGCAAAG
CGAAAGCAGTACAAGAAGCGCTGAAATTTTTATCTGAGGTTTCAAGCGTGTTCTCTATTTTTGGTCGAAGAACTGAAGACATGCTCACACCTTAAACTAC
CACAACCGGCAGTAGTAGTTTGCACGCATTAGCAACACTGTTCGTTTAAGTGCGATGGTGTAACTGCAGTAACTTCAACATCCTCGTCACTTGCTTTGTC
TTCTCGAGATGCTTTATCATTACCTCGTGCACTCGACTTACAACATCAAAACACTACACTCAAGAGCCAACACTAAACTACACTTCTTCCTGTCGACATC
GCAGCCATCGTCGTCTTCATGGGTCGTTTTGCAGTGCCGACAGTGGCAGCAGGAGGTCGATATCTGCCTTGGGGATCCGCTGGTGCTTGAGCGACTGCCG
CGACTGCAGCGTGTCCACCTTGAGCTGGAGCTCGTGTTTCCGCAGCTCGATTTCTTGCTGTCGCCGCTCGGTCTCCAGCCGCATATCTTGTCGGCGCCGC
TCCATCTCGAGCTAAAGGTCCTCCCGCCGCTTTTCCGTCTCGCCACGGTACTGCTCCGTTTCGAGCCGACAGCGAGCGACTGCGACCTCGCACTCGTCCT
TCACCTGCTCCGTGGCGAGACGCAGCTCGCAGACTTTCTCAACCTGCTGCAGATGGCAAGCTTCCATCTTGCGTCGGACCTCAGCAGCGGCGCCTCCGAA
CGTGGCTGGCACGATAGCGCTACTGCCAGCCTCGGCTTGCGTAGTGGACTCCGTGTCGGCTGTGTCTGCCGCAGTCATGCGATCAAGAGCTGGTTGGGTG
CTGCGGCGGCGCTTGCTCCTGCGAGATCCGCTGATACCATCGGTTGCCTTGCGCATCATGTTTCTTGCTGCGTTGCCGCCTCCACCATCGTAGCCGCTGT
CGCCGCTGTCGTCGCCGGTGGTCCAGTCTTTCGGGCCCATGTCGCGCAAATCGATCCGCCGGAAGATCGGTAGCAACACGCGATACTCGGGGCACTCCTT
GGTCACAGCAGCTTCGACATCTTCATCGACAACCTCGCTCTCGAGGTGGTCGCTTGGCTGGCCGCTGCTCCGCAGAATTCGCACCGCAGAGACGAATTGA
TTGACCAGCTTTTCGATCTTGGATTGAACGGCGCTGGCTGTCCGGTGGCGGATCCCGTTCGCTTCCAGCATTGAGAGAATCTCCAGCGATGCGTCACGCT
TCTTTTTGCTCCATTGCTCGATGTGTCCGGGAACCTTCAGCCACCCGACCAGCACGTCCAGCGACGTCGGTCCACCTTGCCCCACGCTGTCGCCGTCCCA
CGGAACTAGACGCTTACTCTTAGCATTTTGGCCGGGATCTGACGGAGCGTGCTTGTTGTTTGTCCTCAGATGCATGCTGCTCGCTCGGGGGAAATCTCCA
AATGACACCAAATCGATAGTTTGGTCGCGCCCGGTCTCAAGTGCCAGCAGCTTCAACCGGTTGACTATCACTTTCGGACAAACTTCTGTAGACAACGTCC
TGCTTCGACCCGCACAACGAACACGAGCGCGGCAGTATCCAAGCAACACAAACAAGCAAGTAACTACAACAGTAGTTAAAATACCTCTCTTGTTGAGGAA
AATGTCGTGTCATCCAGTGCAGGTAGTTCAACAAAGCGTGCCCGACGGCGCGCAGGACTTGGTAGCAGTTTGCAGACTGATATTGATGACTCCCCAGACC
CCAGTAATAGGAAATATTACTCCGAGTTGCGGCAACATCGGCGATCTTCAAATTCCACGCGACCCTCATTGCGAGTCCAGTGCGGGGTTTTGTGTGCTCG
GCGACTGATCTTTGATTTTCATGTATTCCCGTAGTAAAACCAACCAAACAAACAAAAACTTGCGTCTTGGAGACTTTATTTAGAGCTCCAGTGATCGCAG
AGTTTGAGTTTTCTTGGTTATAAATTATAGCTAATAGGTCGAGTGCCGCATACGTAAGTAGGACCTTACATATCTATCTCAGCATCTAAACAGGAAGTAG
ATCATGTTGATGACCACGGCGAACACTGGGGCATCCACGAGACTCAACACAAGAGTGCTTGTTAAGACTCTAGTTTTATTCCCGAACTTTCACGGCCGCT
GTTGAAGCAGGTTTTAATTCCCCGTATTCATTCCGTAAGCCTCAGTTGATGCAGTTGTGACGCGAATGATACGCTTGGAGTCGGCGACTGAGCATCGGAA
TACAAAGTAGTACTTCATACTAGCTCATAAGGGTTTAACGTCACGTCTTGGGGACTTTCAGAGCTCCAGTAAGTGGCTCAACAGGATTATATTTTGCAGC
TTGAGTTTGAGTTCATTGATCATATACTTCAAAGTATATTATTACTACTACGTATTGAACAGTTCCCTGACGCAAACTAGGTGCTAGCAGCACTGACAGT
CATTTTGGGCAACTATACTGTTCGTAGCGTTTGCAAGCTGTGTCGTAGTGTATACTGGATCTGGTTACATGTACCATGATTGCAAGTTAGACATGTATTA
ATACATGTATAAACGGTATGTACGTGGAATGGATTCGACAGCAGCAGTGAGTTGGTGTATTGTGAAAATCGCTAACACGAATTATCCCAATATCGGTGCC
GTTGAACAGGTAGTAGATCTTGTTGACGGGCACCATGAGCCGGTCCAAGAATCCTTTCCCAAACTCCGAGTTTACTAGCGAAGTTTCACGGCAGCTGTTA
AAGCAGCGTTAAGGTCGTTGGCAACCAATAGCTCTTTCACTTTCTCTAGCGTCTCCTTCCCGCTCTTCTCTGCAAACTGCAACGTGTACGCCTCCAAAAT
TTTGTAGCGGAGATCACTTTTGGACAGCTTCGGAACACTTTGTCCAATGTTCAACAAGCGCGCCACGTCCTTTGGCTTAGAATCCACTGTTGTCATCCAT
CTCTGGAACAGATTCCTCTCCAAGCTGTTGCCGAGTCTTTTCAGGTCCGGAACCGTCTGAAGCGACTGGAAAAATGCCGCCAAGTTTACCTCCGGTGTAA
GCGGTCTGGCCTCCAGCAGGAAATTCAGCGCGTGGCGGTCGGAATAGGAACTTTCACCCACTTTAACCTTGTACTTCTCGATGAAGCGTAGCCACTGGAG
GAACATGGCGCTGTCAGCCAACCGTTTTTTCCCAAGCTGTAGAATATTGAAAAAAAACTCTCTGCGGGGTTTCTCCGGAACTCAGCCACACCTCGTTCAT
CCATCTGCGTGTAGCGTCCGGTGAAGCAGGAATTGCTGCATCATGTCCGCTGATTTCTTCATGCCTGGGACCTGTTTAATCGACTGAAGAAGAGCTGCCA
GCTCTGCCTCCGGCGTTGTCTTCTTCAAGAGGTTGAACACATCGAGATCCGAGAACCAGTGCTTCCCCAGCTTGGCTCTGTACAAATCCACGTACTCGAG
CCACTGCAGGAACTTCGGATTGTCGTCGAGCCTTGTCACACTAGCCTCGCCAAGACGCAAAGTCTTGAACACATCGCTCGGGTCGGTTTGAGACTTTAGG
CACTTCTGGTTAGCGACGTTGGGAGAAGACGGACGTATCTTCATTACCAAATCATCGAACTTCGACAGCCTGCTCTCTCTCCATCGTCGTTGTCGTTAGC
TTCGGTATCGGCCGTGAGTGATCTCAGTCTGGGGGCACCTCCGCCCGCTTGGTCGAGCGCTAAAACGACGCCACAATTCGCGAGGAGGGCAACGCAGAGC
AACGGTACCACACACTTCCTGTGCATGTTTCGACGTTGGCACTTTGCGAGAAGTGAGAATCTTAGCCCAAAATGGGGATTAACTTCAGTGGTTTAGGGCC
GCTCTCGGTTGAATTCGTTGATTCCGTACAACCTGAAGGCGCAATCTTCCGAGCATAAAGCACGCTGTAGGTTGTACGGATGGTAGTAGAGACTCTACGA
CACCGTACATGTACACTGTACACTGTAGAGTTGAGTCAACACTGTACACACTCAACTTAGTTGTCTAGGCCTGCTGATGATCGACGTACAGCGGCAAGTT
CGTAATCGAACATCAACGGGAGAGTTCGTAATCCTCTTCATGTTCGCCTTTGTCGGCTGTGAATACTACTAACTTGTTGTACTTTAGTAGAAGAGACTAT
TGAGTTCCCACGGTTAAAGTCCTAGATTTGCTAGCTGTGAATACTACTTCATGGTATGTACTCTCGTCGTCAATCTTCTGATGCGACAAACTGACTTGGA
TCAGGTCAAAGTCGATGGCACAATTTTCTCGAAGGGGAACGAGTTCGATCGGGTTAGTACGCCTGCCTTCGAGAATGGCAAGAATATTAAATCGAAGAAC
TAAGTAAGAACTGACAGGATGCGCTTTCTTGAGTAAATGGCGAGCGCTATCTATCCGACAAAGCACCAGAGTTTCTACGACGTAGTACTTCGTAGAAGTA
GTAAGCACCATCCGGGAGTGTTTAGCGAACAAGTGTGCCAGTGCTGCGGCAAGTTAACAACATTATATATTTGCAGATCAAAACATCAAATGTTTCACCG
TAGCGTGCTACGCTCTGCCTTCACGGCTCGTGCAGCGCCAGCGCCATCTCGATCTCGTCCGTGGCGACGCCTCTGTCCTTCATCGTCTGGCGCGCCAGCA
CCTTGGCCAGCATCACGTCGATGTCGCTCTTGCGCCGTTCCGCGTCAGTACGGTGGCGCTCCGCCTCGGTCCGGTAGCGCTCCGCGTCGATACTGCATTC
GCGCGCCCTCTCCTCAGCGTTGAGGATTCCTTGGCTGCGCTGCTCCGCGTGGCTTAGTACGCACTCGTCCATGCGCTGCTGGAACGCAGGGGTGAGCTGC
GGCTCGGCCACGCGGTCCACCACCCGCCACTCCCGCTTCACTTGCGGCACGTCTTGGGTCGTCGTCGCGGTGTACTGAGCAGCATCGCTACTGGCAGCAT
TTGTTGCCAGCTCCAGGTTATCTTCTGCAGAGAGGGCAGTCACCTCAGGTGCTGGACGCTGGTGGCGCCGCTTGGCCGCGCGAGCTGCCTCCGCCGCGCG
GACATCCGATTCCCTCTTGCGGGTGGACCCCCGTGCGTTGGTTGTCGTCTCAACACTGACGCTACCAACGACCGGGATGAATGGCTCGAGCACGGGGAGA
AGCTCGAAAAAGTGGGGGCACAACCTGTCCACTTGTGCCTGCGTCTCCAGCTCCAGCGCCCCTCGAGCGACCTGGTCACGGCGACCATCCAGGCCCCTCA
GATACGCAGTCGCCGACGAGAACTGCGTCTCGAGACCTCGGATCTTGTGAGAAACGGC