Description :
From Genome Similarity Track
Location :
Scaffold_454:11660- 13327
Transcript NameFunction/comments
Hyaar_Emoy2814153conserved unknown protein
Hyaar_Emoy2814154hypothetical protein

Sequence
1667 bases(100 bases per row)
ACGATTGGTGAAGACGATGGTGTGGTAACGGGTGAAGAAACGGAAGCTGTGGATGAAGACGCTGCTTCTGGCGTGGTCGATTCGACTATAGTTCCGGTCG
TAAATGATGCAGCGGAGATAAAAGCTGCAGAAAAAGATGACAACAAGAAGGCAAAGAATAAAGCGACGACTAAATCGTCCGCTGTGAAAGACACAAAAGC
AAAAGCCATGTCGATGACGAAACGGCAGCTCAAGGTGAAAGAACTAGCTGCAGCTGCTGCAGAGTCAAAGCTTGCTCGTGTAGAGCCTTTGGATCCGGTT
ATACAGGCTCGTGTTGATACGTACAAGATGAAGACTGATGAGCTCACAAGTGTGTACAGAGAGCTCTCACTTTCGGAGCAGGAAAGCGATGTGACTATGC
AAGACATTTATGGCGTTAAACTAGATTACGACCTGGATGTCATCGTGGACGAGAGCAAAGTGCAACAAGTGCTGATGGAGACGTGGCAGAAACTTCAGGA
TCATGCGCGCTCTATTGACAGAGCAGATGTAGTCGTATTGCCCGCTATTGTACCATTTCCCCACGAAGTGAAATGTTTTATTGTGAGAGCGATACAGGGT
CGATCTGCAAGTTTGTCAGTGATGTCGCAGGGACTTTTAGCTGCACTCAAGAAAACCATTGAAGTGGCAAATTGTGATGTGGGAGAAACAAAAACTAAGG
GCGGATCTGATGTAGACCTTGCGGCATCGTTAGCAATGGAGATGGAGATCAAAGCGCTTGCACAACGCATTCCGCATGGTGTGCGTCCTGCGAAGGCAAA
TGTGTTTGAAGACACCACCGTCGATGCACTATGGGTGTGGGAGGTAGGAAGCCCAGAAATGTACTTTGGTGATGAAGCACAGAAGACCGTAAAGCGCATG
CGTAAGCATCGCAAGCGTCTCGGTCAGCAGCTAAAGACACTGGCCAGAGTCGTTCAACTGTTGCACCAGAAGCCGGTAGATGAGGCAAAAGTAAGTTCTG
AGGAGGCAAAGGTTGGGAAGTTTGGGTTCGTAGTGGCTGCTGAACTACAAAAGGCGAGGGACAAGGAGGTGAAAATGGTAGAGAAACGCGCTGTTGCTGA
GGAGAAAAAGTTGCTGGATATGCGCCGTCTTTTAGAGCGTCAGGAGGCAAAGGATGAAGAGAAACGGAAGCGTGATCGTGAAGCGGAGGAAAAGGAGCTT
GAGTCATTCAAGGCGCAAAAGAAATTCAAGTCTTTTTTTGCGTCTGATGCAGCCAACGGTAGTGGAACCTGTGACTCCATCACAGATGTGACATGCGATG
ACGACGAATTGCAGGCCGTCCATCCAGAAAGTTGCAGCACAAAGATTGCTCGCATGGACGCAGCTATTGGCTTTCTGGGTTCAGCGACGGATCCGTCACT
CGGTGATCCACCAGACCCATCGTTTCAATCCAGTGTCTCGATGCTGAAAGGCAAACGAGGTACTACCAGCAATACTGATCTGACTTCTTCTAGCTGGAGT
TCTCGGCGCCACCGCGACCCGAAGTTTGGTGTGATGAAGTTGCTGCAGTTTCACGAGAACAACCGGCCAGCGTATTACGGCACTTTCAGCAAGCGAAGCC
GGCTTTTCCGTGTGTCGCCGTCCATTTACGCAGTATTCCAAATTCGACTACAGTGTTGATAGCGACG