Description :
From Genome Similarity Track
Location :
Scaffold_2450:1166- 2582
Transcript NameFunction/comments
Phypl_g15095hypothetical protein

Sequence
1416 bases(100 bases per row)
CCCGACCGAACAATGTCTTGGACTTGTGTANACCTTCAACAGTAAGAGAAGAGCTagcacctcctcctcggtcaGATGGTAATTCATCTCAGCATCCTTC
AATACGCGGCCACAGAACCGGACTGGATGCAATCGCCCGTCGTGCTCTTACATCAACGTGGAACCCAGAACCCACTCATTCGCAAATAGCATGACATGCA
CGGCCTTGTCTCGGTCGAAATGCCGCAGTATTGGTGCGGTCACAACCCTCTGTTGCAGCGCCGTAAAACTCCGCTTGGCTACCGTGACGTCACCCCCGGG
TAGGAAATCTTCGTCTTTCAGCTGGCACAGAGCAGCTCCATACACAGCAAAGTCCTGGATGAACCGGCTGTAATAGTTGAGTGCCCCAAGGAACGACTGC
ATTCCCTTCTTCGACGTCGGGAACGGCAGCTCGGACACGGCTTTTACCTTCTTGGAATCGGCTCGTATACCCTCAGACGACACCTCGTGCGACAGGAAGT
CCACCCCTGACTGGACGAAGATGCCTTTCGTGAAGCTAACACTGATCCGACACTCTGTAAAGCGCTGAAGCAGCCGGTCGAGAGTCGTTAAACACGCATC
AAACGTCTCTGAGCCAAAGCAAATATCATCCACAAACGATCGTTGATCGAACACAGGCACCAACGAGGATTCGTCGGGCTCGCCATTAGCGAACATGTCC
ACAATCGGACTGTTCACCAGCAAGGCGACGGCATCCATGTTGGTCGAGGACGCTCGGTCGGCCTCAAACTTGGTCGGACAGGCTGTCATATCGTCCCTGA
GCAGCGGAGAGTCCTCGGTCACCCCTGTCCGAGCAGCATTGGCTTCCTCCTCAGCGGCCCGCATGAGCTCCGAgaagtgtagccatccgCCTTTCGGTTG
GACAAAACCCCATAGAGTGTTGTCGATCATCCGCTGATAAATCATCGGCGCATCCTTGAGCCCGAATGGCATTCGTAGCCACTCGAAGTGCCCCAGTGCG
CTCACGNGTGCGCTCACGAAGGAGTAGGCCTTCCGAGCTCTCATGGTCATCAGGATGGCCCAGAATCCGCTGGCTGCATCCAAGGAGCAGAACCATAGGT
AGGCCTCCATATCTGTCAACAAATCATCCACAAGCGGCATAGCGTATTCCATGATCGCGGTCACCGCGTTCAGCATCTTGTAGTCGATGCATAGACGGAT
ATCAACGCCGTTTTTCTTGAGGACAATCACAATCGGCGACGCCCATGGGCTGTCCGAGAACGCGATCAGGCCAGCCTTCAGCAACCTCTTCAGAAGCTCA
TACAGCTTCCGAAGATGGCGGAGCGGTGTCCTCCGAGCCCTCTGTTTGATCGATGGGTTTCGCTGTACGTCGATATCGCATACCACGCCGTACACAGGCG
GCGGAAGAGCATTCCC