Description :
From Genome Similarity Track
Location :
Scaffold_14:116582- 121963
Sequence
5381 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGGTGGATCTACATGTCGTCAAGTACCATCGCTAGACCATTC
TACACGATAACATAAACCTAACAACATATCGCAATGGAATCACGTGGCGGTTCACAGAGTCGAGCTTAAACAACTGCGATTAAACAGAGCCTATACTAGA
TGCAAAACCATCATCGTCGACTGGTTTATTTTAACACCTCAGAAGAGTTGCACATTACGTCAAATTGCTCACCACCCCAGCTGTACGTTTCATGTAGTGT
ATTCATGTCATCGTGATTGAGTTCAGATTGGTGCTGAAATAAACCTTCGCTCAATGCTAGGAACATGGTAGTCGGCCCGGGGTTGCTGCAGGACGAACTC
ATTCGAAAATCAGCAAACAGGATCATGGGAGTGCTGCTGTAAGAACGGAACATCTTAAAGTATTCTTTGCAGGACGATGCGGTGATCTGGAAAGTTTGGT
TACCAGCCAATTTCAATAAGCGAACGATGTGGTTTTCAAGATCCATACAATAGTGCAGCAACACGGTTTGCGTTTTATCGATAGATACCTGTATTCATTA
GTCATTACATACGATAAATTTTCAGGAATGATACAAATCACTCTCTAACATTAGCCTAGACCATGCAGGGTCCCACTTTCAGGTAAGGTATGCATGTAAG
GTTTATGGATGCCTCCTAAACACATGAACAATATATATCTGTCTGTGTTAGCACTGCGAGGTGTTACGAAACTTGCTGCTATGTCAAGACCCAGGGTAAG
TCGCGGCGAGAATGCTCTAGATACCGCTAACTGAGCGGCCTTTGAAGCTTTGGTAGGGTAACGACCAAAATGGTGGACTTTGCGGTCGAATAGGGCTTGC
TTTTATTGTCATGGCGCTTGCTGCGATAAATTCCATCGACTGAAAGTAAATGGCGCCAACTGGAAGGCGTGGAGGCACCTGCATAAGCATTAAGGACTTC
GTGGATCAAAATTTGAATACTCATTAGCATTTAAAAGTGGACGTTGCTTCTCTTCGCCTGCGTTTGCTTCTGGCTCGCTTCACTCTGCTTCTGGATCTCT
TTCGTCAGCTGTTGCTTCCTCGGCCTTGGTAACGTTTGAGTTGACCGGCGTGTAGTTCTGGAATAATCCAATCTGCATTTCAACGGAAAGTGGTAGAGAG
TTAATTTTACCACTTTCTGTTGCATACCCTGGGTTAATATTTTATTACATTCGGGTTAACGGGATTGCAGCCTGGTCTATAGTAGAACATGGAGCCACCT
ATAGGCAGGCGACATTTATATTTGAAAACCAGGGCAACTACAATCAACAAACCAAAACACTACATACCGGTGGGTAGCCTCCATTTTGCACCGGAACACC
AAACGGCTACATATATCATCGAGCAGACTTATTAACTGCTTAGACAGGAGCAGTTAAATTACTAAGCATGCACATTACATCCTGCAAATAGCCTCCATAT
CCCATCAGACTGCCCTATAAGGCCAATGGTGTCCCAATTCATAGTTCGTGTGTTTGCTGAGATTTGTAGTCATTTATGTCATCTGACAGTTGTAAAGGTT
ACCCGACAAGGGCTTCGCTAATTTCTCTCCACGAATTTTTATACACTTGGCACTACGTGTCGCTTCTCTATGTCTATGTCACAGTAAGTTCATTAGTATG
ACCTTGTTATTCAACTAAGCTCGCGGTTCCAATATCGTTTCCGTGTTTACGACCAAAGTTTCTTGAGATCAAGCTCGGATTCGCAAGACGTGGAACCACT
CGATTTGACTACCGACTGCGACGATCGCACTCCAATTCTCGCCGTATCTTTTTTCGTCGTCTATGCTCCATCAAAATGGTGAGAAGTGTCCTTTCCCGAT
GTCAATGACGGAGACTATTTTAGTACTACTTTTCCACGCAAACAAAATGCTGAGTCTGACTAGTAATCAAGTATTCCAGGTCCTTGTTTAACGGGTTCAA
TGATCTGGTCGTAGCCCGACATCTGCTGTATGCACCCCTTTTATTCGGTAATGGCTTCAAATATGATTACAAGAACTTTAATGCTACTGATGCGTTTGGG
TGGGGCGTTATTTTATTCTTCCTTCGACTATGTTTTTGCATGGATGTCTCAATATGTATAGCTGCATGACGCCATCCACTAGATCTCAAGAGCAGCAGAT
TCGTAACTCGGAACTGACACAGTCTTCATTAATAATGTGAGGAATATAGTGATCTGCAAATGATAATTAATACAGCTTTGCAACTTACAAGCTACTAACT
ACATCTTCATATAAATAAGTAAGGCGGAAAAGGATTTAACGAGCTCGAATGAATATGGGCATGTTGGTAGTAAATCTAATACTGCTCAATATGAGATCGC
ATTTTATATTTTTCCTAAAAGGTCGTCGAATTCAGGTTTAGATTAACTTCAATTTCTTCTACGGTAGCTGTTCAGTGTGAGACGCCTGCGACACTTAGTA
TCCGTCCCGATAGAGATCAGGTAGTTCTGGACGCGATTAAACGCCTCGCCGTCAGTGTCGCGCAGCGTGTTATCCGCTATATGGAAGTTAGTCAAACTCA
CGCACGTCTGGAAATATCAACATATAAATCGTGTCCTCACCTATACTTGTCGGTGCAAATTGGTCATAAGGTACTCAGCCTCCCCACCTAGTCCCGACAA
TTATCCTGTCACTCGATATCTTGTCATTATCACGCTCCTCATTTGCTCAAAGACGGTTTCCTGGGGGCGCTCTTGTAGGATGTATATACCGTAGCTACGA
CCAAGTCCTTGATCCACTTATCCGCTAAGAGCACCCTCTTGCGAGAATTGGACATCTCTACGGCCGCGGTCTTCGAGTGCCAGATCTTTCTCTGTCTCGA
TACGCATCTTCTTGTGAAAATCGAGATTGTGTCGGAAGACTTGGATATCCGCGACACTTTCTTTCGCAAATTTTGTGCAGTTGATGGTGAAACCGCGAGG
GTTCACTGAAGCCTCCACCTTCCGTCCATACGGGTGGTGCTTGCGATTATATGGCGTAATCGCGCATGAAAAACTGAGAAAATTACATCCAAACGTCACC
AGAAAGCGCAAGTTATTTTCGTATGCTCGTGGTATGTGGAGGAGGTGTATGACGAAGACGTGAATGAAGTGAAGCGGATGGGCTTGGAAATGAGTGACAA
AATTCTCCAGTGGAATTATTCCAGATACAAGTATGATAATTACTGAGTAATTGGATAAAGATCGACCACAGTGGAGATGATACAGAGAAATGGCTGTGAT
CTACAAATAAAGCTGTTCATCTATCTGTCAACCACTAAGTTACTAAGTCAATAACTGTTCCACATGAGTGATTTGGTTGGACACAGAGCAGCAAATATGG
TGGTCAGTTTCTGGTAGAAAGGTCTACTGGATACGTGTCAGCTGGGAAAGTTCGCGCCACATTAGCAAATGACAATTATGACTCAAAATTCGCAACATCC
CACCAAGTCACGCTACAAATATCTCTGCTGACTCGTTATCAATATGTGATTCTTAAAATGCCCGGTCGTTTTTGCAAAATGCCTGCATTCGTACGATTAC
TTAGTATGTCTCTTTCTGGATGTATGCATCCCTCTTTCTTCGCAGGTCAGACAGTGAGATTTGCACCTTCGTTTCCTTAGTTAAGTGCATCCATGGTCTT
CGTGGCTTGACGTTCCGTCGCAGCCTAGAGCGACATTCGGTCTAAAAGAGGTAGCAGTCCCGTGAAATTGCCATTGGTAGGCCATTTCGCGTCGCGGCTG
CTGAAAAACCGCGATTACAATAAGCACTTGAGTAACTTTGACAGCAGTGCGCGACCCTTGTGTATTTTCACACTTCAGCCACATCCATAGCGTGCGCAAA
TAGGACAGGTCACAAGGACACGGTGAGAACGGGTGAACCTCTCGAGGATGCTGACGTGGACCACCCCTGCATCGCAGGCCTAGGAAACACGCGGGATCGT
TGCTTAATTTGAACACGGGCATCGCGCAAACAAAGGCACGTGTTGTAAATGACCAATGTCCCGAGGCGATCATACTTACTAATGTATATTTACTCATTTT
TGAACGGTGCCGATTGTGGTCGAGAATGACTGACAGCTTTGTACCGCTATTGTAAAGCCTCATTGCATCGTAAACTACACTTGGCGCGGCTGGTATGTCT
TGCTGCAGGCAACACAGCCTGTTCCTCTTCGCTTTCCAGCAGGTGTTCAAGATACTAATTTATGGCTACTCCAACCAGTAAGAACCGCTACTCGACCGAA
TAGATATATTGTACGGGCAACTATCTTTAGTAGAAGCTCTCCTCCGCCTATTGGAGATGGTCGGAGGATTTCGGGTGATGCCTTCTTCCTGTATACATTC
CACACACACTCGATACTCGCTCTGCCTTTCTATACGCAGTGCGAATCCTCTTCGACGCGTAGGCAAAAGCTACATCCTTGGCAGAAAATTACATTCTCGC
AATATTTGCTAGAAGTTACTCCTGTAGTGTCCACCTCGCCGTTGATCTTATCGCTGGTTGTAATGCCATTTCTTGGAAGCATTCCGGCATGGAAGCGATG
TTACCATTGGTGTCGGCCATGTAGCTTACGCTATGGATAAATAACATTAAATCTCCGACCACACTTGAATAACGTATTGATCGTATTGACCAATAGTGTG
AGCGTAGTGATATAAAACCCTTTTTTAGCGAGTCAAATTGAACAAAGGCAATATTTATAATCAATAAGAGAGTAAATGAACAAGTAAAGCTCTCGCAGCT
ACCTCTCCGACGTATCAGGTCGGAGACAGCAGTGCTGTTATGAATATCACTTTACAAACGCCAAGTCATTCGTATATTTTAAAAATAACATCCAAGCTCC
GACATCTCCGACAAAAGGCCAATCGCATATTTTACAAACAACATCCAAGCTTCAACATCTCCGCCAAGGATGATTCTGACCGACCTTGCACCTGCCAACA
CGAAGCGTGCCCGTGAGAACGCAGCGCGCTCATTTTTGAAGTTCCTAGAGGAAGAAGAGGTTACTTGGGAGTACCTGCGACAGTGCATGCAGCGCGGGAG
GGCACCTCTCGCCTTAGAAGCTGTGATGGACAAGTTGGGTATGTATCTCGCGTTAAGGAGGGCCGAAAGGGACAGCTCTTA