Description :
From Genome Similarity Track
Location :
Scaffold_604:11658- 13661
Sequence
2003 bases(100 bases per row)
TCGGTGGCGAGTGCAAAGCATTCAGCACTGCTGAAGGCACCTCGCCCACCTATCAACGGTGATACACCAGCCGCCAAGCGCGTTTTCGACCGCGTACAAG
CGCTGATGCAGAATGATGAGTGGATGCAGCTGTTCAAGCCCATCCCCAAGAAAAAGGCCGACTGGCCTGCGCTTGCGCAGGAACTTCAATACCCAGTCAG
CTCGGTTTCGACTAGTCAAGTTGCCGAGGATTCAGTTTCGCTACTGTTGTCGCTGGGGTTCGAGAACGAGACGTACCCATCGACGATGTCGCTCCAGGAT
TGGAGTCCACATGAAGCCGGAGCTGCTCTCCAGAAATGGAAGAAGAAGCTTCGGAAGGCGTTTGGCGCTGTTGGCATCAATGCCGGAAAGCAGCCTGTGA
GTCGACCGATGATTCAAGATGAAGATCCGTCCAAGATTCCACTGCCGCCGACGCCCCAACGACTCGTTCGTTCTCCTCCGACCAAGCGTGGAGCTGTGTG
TGGTGCCTTTGGCACTACCGAAGCCTCATCGTACTTTCAAGACTCGCACATGGTTCCGCCACGTTCGGAGAGCCGTATGCAACGCATTTACGCAAGTAAC
GAGGGTTCGTTCGGTCGCCGAGGCGGTGCGCGAGCTCCCAAAGGTGGTGCCGGACGTCGTCAAGTCGACAGCGAGGGTTCGTCCAGTGACGATGACATTT
TGGTGCGTACATTCGACGAGGAGGATCCTCAAGTCGAGTTGATGCGTCAGATAAATGAGCTGGCGACCCTGAACGACGTGGACCCTACACCGAGGATTGA
AATGGCATCGCACCGACCATTGGATCGCATCACGCCGTTCTCAGGCTCTCGCAACAAGAGCGAGAACTGTATGCAGTGGCTCCGTGGGTTCGTCTATGAA
ATGACTGGAACCCACACAGATGCCGATAAATGGTGCATTTCATTTGAGCTAAGTCTCCGGGACGGAGCCATTCATTGGTTCCGTCAACTTCCGAAGAAGA
CGAAGCGCAAGTGGAAGCTGCTGAGCGACGCGTTCATCCGCTACTACTGCTCGCAGCTCACTCAGACGGCACTGTCGCGTTACTACTCCGCCAAGCGAGA
ACGTAATGAACATCTGTGCGACTACATAAACAGGCTGAATGGCTACGCACGGACCGCCCGTCTACACTTCAAGAAGAGTGGCCGCGACGCGAAAGAACAC
GTACAGCAGTTCCTTGCAACATGCGATGATTACAAGTTGGCGGAGAGTATTTACCACGCTCGAGTCGCCGACATTCACGAGCTCGAAGAGATCATCGAAG
ATGTTCTCAAGGGCAAGGAGAGGATGGCCAAGCGTGACAGTGAGTACCGATACTCCAAGAGTCGTGATACGCGACGCGACGATGGGTACGCCCGCAACAA
CCGGCGTGATGACCGTCGCCGCGATGACAACCGAAACAAACCGAGAGTGACGCTCATTGAAGCCACGGTGGATGACCTACTAGCTGAATTAGAAGGTCGT
GAAGCTGCTTAGGGAGGCAACGAGTATTCAAACGAAGATCCGAGCGCTTACGACGATGTCCACGCATAAGCCCTAGCAGCTGACGAAGGTTGTCTTTGTG
CATCTCAACGTCGGTCTTCCCGTCCACAGCCCGGCTGTGAACGAGCACGTCGTCGAAGTAGCTCGGTGATATTGCCGCACTAAGCGTAATAGATGTGTGA
CACATCTATTGAAGGTTGCGGTGTTCTTTAGTCCCTGGGGCATTACGAGCCACCCCCCAAACATACCGCTTGGAATGCTCACCGCCGTGAGAGGGATATC
CCTCTCACATATCCGGATCTGATAGAACCCGTCGCGCAAATCGAGAGCACTATAAATGGTGCTCCTGGCCATATAATCGATCATAACATCGTTTCGTGGT
ATCGGCGTCTGCGCCGGTATCGTCGCATCGCTCAGCTTCTTGTACGCATGAACAATGCGCCACCCGCCCTGTGGCTTCTTGACACAGAATGTTGGTGCAC
TGT