Description :
From Genome Similarity Track
Location :
Scaffold_28:11658- 13564
Transcript NameFunction/comments
Phyke_g1756hypothetical protein PHYSODRAFT_310358

Sequence
1906 bases(100 bases per row)
GTGTTAACCCAGTATGGTGTCATGAGACCACAGCATGTGCTGCAACAGGTAATTCAGCATTTTTTCTTCATGCAGGGAATATAAGTTGGATAGTGGCTGC
AACGCAAAAAATGGTAGAAATCCCAGCCACCAATACCAGAAAGATCAACCGAGTCTTGCCCTTGCGTTTTGAACGCCACGATGACAGTCGCGCGTAAAAG
ACCAGCGGGAATAGATAGCACAGCATCAAAAGAATGCTTGCTCCAACGAATGAAAACACCACTTGGAGCCCAGGAACGCGCAAGGCACACAAAATCTGGG
CTACCACCAACAACACCGTCACAACACTTTGTACTGTCCTCGACGGAGCctcatcttgttcttcctcctcaccAAGCAGATCATTTCCCTCATCCTTGTA
AGAGGTGAAAGCCACATACATTTCAAGTATGAGCGAGCGCAATGGGTGAAACAGGAGCGGGAATGAGAGCAGGATCGTCAGCAGTACAGCCACGCGGGGT
ACAACCATGATTGGGTCATGCGATAAATTCAACAGGATATTACCCTGCGTGTTGCTTCCATAAATCCGCGCAGCACAAATCCCGAAGGTCGCATACAGCA
ACACGCACATTCCTACGGCCACGCCCAGATGACGTCGCATGgttcgtccagcagcttgcagtAGATGCACTGCTACAGGGGCCTCTGTACTGCCAAGTTC
TTCGATGTCCCTATCGTGTTGATCTCTCCGCTGAGCCGTTTCAGATGTCACAAGCTGAGCTAGTAGAGGAATCACGTTTAAGTGAAGCATGAAAGTAAAA
TTGTAGATGCCCACTACCTCAGCCACACGCCAAAACAATGACACCTCACTCTTTTGAGCCCTTGGCAACGCAGCACGATAGAtttcaccatcttctccac
cCCCAACTGCAGCCCGATACGCCACAGCTGCCACGAGATAAATAGAAAATACCACTCCAAGATATGACGAAAACCGTAGCGCCGAGATCTTGGTCAGACA
ACCAAGTGGCAGcaccacgaccagcaccacgaccCAAACTGCAATCACCacatcgtgctgctgttctacCGGTGCTCTCTGGTTAAAATCTGTTATCACC
GCGGACAGAATCATCGGTGCCATGTCCTTTACCACCCTCACACAGCCCACGCATGCTCCAAACACCGCGAAAGCTGTTAATGCCCCAGTCAGTCGAGCCA
GCGGCTTGCCGCCAGCTCTCAACGCCAAATGCTGGTACGTCTCCCGACTCTCCTGTACTCCACCGCTACTATCCAGCGCTACAGTCACATGAACATCAAC
CAATGTATCTGCCGTAAAGGCCATTGCCAGCCccacacaacacaacaccAGTACTGCCTGGACtggcgacagcagcacgaacgtATAGGGAACCGCCAAA
GTGccagctccaattgctgaCATCAATAGAGTGAAAGACACGGCGCAATTCCGCCCCAACCATAGGCAAGgtgacgttgttgttgttattgtaGCAGGTT
GTGGATCATCAACGACGGGGTCGAGATGTTTGACAATTGTCTGGGCTTCCACTTCTTCGGATATAACCAATGGGAATCCTATTTCAAACGATGGGCGGCG
GTGTCGACGACTGGAAAgaggcgaaggagacgaCAGGAGTAATGGAGACGCCTCGTTCGAGATCCCCATGGTAGCCGAATGAGCAGTTCGAGGCGGGTTG
ACAAGTGAGCTCTACGTCACGTCGGACCATAATGCTTTACGACTACACGAGGCACATTTAAGCGAATCAAACTGAGTCAAGTGGGAGCTGATTGGCTATT
ATTTGTTAACGAAGCTGTTGCTAAGAGCTCAAGTCTTTATATGTTATTTCACCAAGTAATCAACTCTATGCTCTACTCACTTTGTTATTGTGTGTTGGTT
TCCATG