Description :
From Genome Similarity Track
Location :
contig_1:116504- 121910
Transcript NameFunction/comments
g23.t1hypothetical protein

Sequence
5406 bases(100 bases per row)
CGACGGATAATGGACGGATCGTGGGCATTGGTACAGGTGCCGGTGCACGTTAGAGGATTGGTGTATCCGTTGACGAGGCCAGCAACGAGGAGAGGAAGTC
CGACGAGAATAGAGAGCACCTTCATGCTTTTAAGTAGGCACGGCTTCGTTATTGGTGCTGTCAAAATTGAAAGTGAAGAGCTCTTCTTGTTGGGCCGTTG
ACACGCCACACCGTTCGAACAGCACAGTCCACCATCAGGCTGTGCCTTTACCGTTGTGTTGACTTTTCACCGACGTTTCGTATGTTCTGACTGTGGCGTG
GCGTACCCGCCAGATGAATCTAGGGTCCCGGCTGGGATTAGCATTGTATGGATTTGCTGGAAGTGCTCAAGCCTTGAGTCAAGGACCCAAACGTATCAAG
TGTATGGTAAACATTATCGGCTCCATCCGAGAATCGAGACGCATTGGCAACCTGGACCACGAGCTCTGAGGCGCATAGCTTTCAGTGTAGGTGTAGTATT
GAGCGAATTCTATTCACAAGTTGCAGGCAATACGACTTTATAACGGTTCTAAATCCTTTCTAATAGTAGTAAAGCGCTAATGCAAATATCGGCAGCGTTT
GCTTGGACCCCACTGAAATGCCTATCTTGACAAGAATCCATTTCTTCCTGAATCCCGGTTGGCACACACAAAGTCTCCGCCTGACGGCACGACAATGCAC
CCGTAGGGAATGCCACGGCACAGGAGCGATCAAGTATTTGTCGCGACGACTTGTCAACGCGTTCTCGTTGTTCGCATGTCAGTCAGGATGACACAAATTT
GGCGTAAGCTTATGGTGCATGTAGATTCTTCATACATGCAGTGAATCGTAGGCGTAGCAACTGCCTGGTACATGCATGTGCTAGTTAACCCCAAGAGCGT
TCTCCCAAAACAGGGGCCTTCCGAAGAAAATTACCATCAACATAGGAATGGTTTCTACCCTATTCATGACACACTGCATCGACGACCCCTCCTCGCTCCT
CTGAGAGTGCTTAGACGGTGGGCCAGCCGCTGGAGAAGTCGAGCTGGTTCCAACCGAATTTCTTGTCTCCATCCGCATACCTAATCCGGGTGTCCACTGC
ACCAAACAGTCAGGAAAGCCGTCAGTGATAATAGGACAACAAAGGTAAATGAAGCGCGGCTTGCCGTAGTGGTAGTACAGCACGGGGCCGTACTTGGGGT
CATTGTACACCCCCTGGCCTCCTGGTCCGTAGACGTAGCTATGAGACTCGAGCACAACCGTGCCGCCGTTGTTCGTACAGTCGTTGCCGTTCTTGTCAAC
AAACCCGGACGTAGCATGCTTTGAGCGGCACACGAGGATACGGTACTCCTTCCCCGTGGCAGGTCGTGACGTGTCGTAGCCACAGCAAGTGCCCTTCGAG
AAGAAGAGATAGTAGTAGCCGTTGTACGAGAACATGTATGCAGCCTCGACCACCTCGTAGTTGGATGTGAACGCCATTTGATACGCCGCTGCCCCACCGG
TTTTCGTCGGAGTTGACTTCATCTTCACCTGGTAGATGTCCTGCCAGTAGCTGCTGAAATTGAGGAAGTACTGGCTGCCAACCTGGAACAGGTTCGGATC
GATGGCGTTGTACTTCTTAGACGAGTCGCTCGTGACGCCAATGCTGCCAAGATCGGTCCACGAGCCTGCCTCCATTGTCGTGGACCGGGTGAGGCCGACG
GCAGAATTTTGAGTTCCGAAGGAGCTCACCGAGTAGTACAAGTAGTACAGGTCGCCAACCTTGTGCACGTCTGGGGCCTACAAAACAGAACGAGTGGGTC
ACTATCAGTAGGATAACATCCAGGGACAACGAACACACTCACCCAGAGATCATCCTTGCCCGTCAAATTAATCTTCGAGCCAGTGGGCACTGCAGCTCCG
AGATACGTCCATGGGCCCGTCAACGCCGGGGCCGAGTGGATGGCGATCTTGTTGCCCGTGGAGAAGCGGAAATAGGTGCCATCATCGCGCCGAATAATGG
ACGGGTCGTGGGCGTTGGTGCAGGTTCCGGTGCACAGCTTGGGGTTGGCATACCCGTTGACGAGACCAGCGCCGAGCAGTAGGAGAACGAGGATCGAGAA
CAGCTTCATGGCAAAAGAGTCGAGACGATCAGAATCGAAAGTGCTATTATAACTACTGCACACCTAGGCGGCCGGTAGAGGACTCCGAGTTTGTACGCCG
TGTGTGCCTCCATAGCAAAGAGAGGTTTTGCATGAGCTGTTACCAGCTGCATTGTTGGCGATCACGTCGTATGAAGGTGCCAAAAGCGTAGGATGTTTTG
ACCGGCATCCATGACGACGACACGCGCGAAGATTCATTGGGAGACCTGGGTCACCAGCAAGTTGCTGCTGGCAGCAACGGAGCAACTATCAAACTGCACT
TCAACAAGCTTGAAGCATTTTTCTGTACGAATCCATTTGCTTTGATGTGTGTTTCAAAAGGAAGACCACGATGTAGAGGTCAGGTCCAACACAAGGATGC
TACAGTCTATTGCATCAAAAACGAACCGCACAAAGACACAAAGGTGAGCCACGGTCATCACGACGAAGTTATCGCGATGTACGTCTTGAACGATGAGGCT
GTTGGTATTGACTTAGTTGTTGAAACTGTACGACAGCGACTTTTGCACGGCTACGGTGCCTACAGAAAACAAAATACATGTACATCTACTGGTAGTGTGT
ATGCGATGCTTCTTCACTCTAGCGCATCGCCACCTTAGTTGAGCACGCCGATGCCGAAGTTGTTGGTGGTCTTGCTGTGCTTCTTCGCCGCGCTCGGACT
GTAGCTGGAGATGGCCGAGTACGACTTTGCCGTGGATAGAGCCGTCGCACCGTTGCGGGACTGAAACGCTCCGCTGTTGTCTACCACGTTGGCGGCGCAG
GAGCGACCGAGGTAGCTGTTGCACTCGGTGGTGGCGGTGGCGGCGTAGAGGGCGCCATCCGAGCCGGTCAGCAGCGGCAGCGTCGTGTCCTGGAAGTAGT
TGCCCTCGGCGAGCACCCATGCGTTGACGCCGATCTCGAACGAGTGGCCCGAGTTGTCCGCCCAGTAGTTGTTGGCGATGTGCGCGACGACGTTGGCGCT
GCTGTCGCCACCGATCTTGGGCGAGCGTCCCGATGTTGAATGAACGTAGTTGTTGAGCATGCTGAAGCGGGTGTTCTTGCCGTAGAAGATGAAGGACCAG
TAGTGGCGACCGTCACACGTAGCCGAGTAGTCCGTGCGGCCGTCGAAGTCCGAGTTGCTGATGGTCATCGTGGACACACTGGCGGCGTTCGTCGTCAAGA
ACTGACGGCCGACGTGGGAGACCTTGATGTGGTCCAGCCAGATCTTGTTCATGGCCGTCGAGCCGCCGTTGCTGCCCTGCATGTAGAAGGCGTCGCCACC
CCACACCAAGTGGCGGTTGAGCTCCGTGATGTGGATGTTTTGCACGATGATATTGTCGCCGTTCAGCCACAGACCCTTGCCCATGATGACACCGCTCGTG
CCAATGCCGCGGATGGTCTTGCTGCCAGTCACCGTGAGTGGGGTGATGGCTGCGTTGTCGTACGTGACCGTCACGCTGGTGCCGTCCGAGCAGCCACCCG
TGTTGGACATGCCACCGCTCTGCAGGATGACATCCTGGCTCTTGTAGCCATTGTTCTTGGCGATACACTCCCGGGTGTAGTCTGGGCGGCAACCAGCTTC
GGTCGTCGTGCCCTCCGTGCCGCGGAAGTCGAACGTCTTGTTGAGCACGATGACACGGGGCACGGCGTCCTTTAGGTACGCGACGAGCTGCGCCGTCGTG
GTGGGGTACACGGGGGTGGCGCTGCCTCCGCCTGTGGTTCCGGCAGCGAGACCGGTGGCCGATCCGACCGTGAAGGCGTCCGTGGCCTGGACCACGATAG
CCACCACCACAATGAGAATGGGACGGAAGAACTGCATTATCGCGAGTGTTTGGAGGTTCGTGAGCGGCGTGAAGCAAATTGGGGAATGACATGCTGGTGG
CGGTGGCAGACTGCGGAGCTTGTTGTAGTGTCCCGCTGTTAGAGAGGGTGCGGCTGCCCGAAGCGATCGTATCGGCACGGGCGAGGACGCCCTGATCGGG
TTGCACACGCGCTGGGTGCATCTATTGAGCTCGGATGATCCATCTGCTTTATCGTGGATGTCATGCGACTAGCAAGACGGTATCCTGTTCGATTTCGCCA
TCTGCCACTCCGACATGGCGAAATGGAGAGACCAGGCGGCGGCGTGCTGATGCACCGCTCGATTGAAGTGAGCGTAAAACTTGACGCCCCTAGGTGACCC
CAACAAAAACACTATGGTTACAGCGGAGGGATATGCGGTTGGACCAGACAGTTGTGGCGTCGAGTTGCTTACCGGTACGTGTATGCAGGTGACATCGATG
GTTTACACACATCCTAGGGTACCGATGTTTTATACAAGTTTTGAATGCTGCGAGGATGTGGCACTCGAAATGCCCAAAGCTACGAAGGCATCCAGACTGG
CGCAGGATGCAATCCACTGGGGGCAATCAACGTGCTTGGTTCGTTGCATTCATCTTTGCAGCCCTTGTTCCAAATACACTGTATACACACAGTAGGGACT
TCCCATGAAAACGAGTTGGGGTGCAGTGTGAACTGGCCATAAAACGGGTGTGGAGTTCTGCGTAGACCTCGGTGGCTTACGAGACGCTGCTCGGCTGCTT
GCTTCCCAGAGCGTTGAGTAAATTCTACAATTTTCAGCACAAAAGTGCAACGTTTACAAACTTCTACTCGACAACGAAACTACATGGCATGCAGTACATC
TGTCTACAATGCCACCAGGTTACCTCTACTGGTAGCCAAAACGTTTCGTTGTCCGTCGCGGCACGACTGTGAAGACCACCAACTACATCAATGTCTGTTG
GCGGAACAGGTAGTAGTGTGACGGTCGGTAGTACCTACGACCTGCCTCTATGGAAACCTTAGCTAGACGCAGCAGCATCCAGTGTGTGGTGGCTCAAGTC
GAGCACCATCATCAAGTTGAGTGGCGTGCTTGAACTTGGACGATCAGCAATGGTAGGTAGGGGCGTGAAACATTCATTGATTTAGTTCAGTTCACAATAA
GCAACCCAGCGAGCAATACACTCATTGACCGTTATTTACCTAAAAAACGTTAGATTGGTGTTCCCATCGCCATGTTGGGAATAGTACCAAAACCTTAATT
CGTAAGTCCTCGGTGACCCCATTCAGCCTTCAAAAATAGCATTCTCGTCTTCGTGACCTTGTCTGCGTCGTCCCTGCCCACCTATGTAGCCTATCTGCGT
TGTTGATGCCCTGCTAAAGTGTTTCATGCCTCACCAATCAACACCGTATTCTCAAATAGTCTCCCCAGTCACTACAAGCCCCCGCAACCCTCCGCTTAAC
CTCTCA