Description :
From Genome Similarity Track
Location :
contig_1:116502- 121909
Transcript NameFunction/comments
g30.t1hypothetical protein
g31.t1OWZ12961.1 Pectate lyase [Phytophthora megakarya

Sequence
5407 bases(100 bases per row)
TGCACGTTAGAGGATTGGTGTATCCGTTGACGAGGCCAGCAACGAGGAGAGGAAGTCCGACGAGAATAGAGAGCACCTTCATGCTTTTAAGTAGGCACGG
CTTCGTTATTGGTGCTGTCAAAATTGAAAGTGAAGAGCTCTTCTTGTTGGGCCGTTGACACGCCACACCGTTCGAACAGCACAGTCCACCATCAGGCTGT
GCCTTTACCGTTGTGTTGACTTTTCACCGACGTTTCGTATGTTCTGACTGTGGCGTGGCGTACCCGCCAGATGAATCTAGGGTCCCGGCTGGGATTAGCA
TTGTATGGATTTGCTGGAAGTGCTCAAGCCTTGAGTCAAGGACCCAAACGTATCAAGTGTATGGTAAACATTATCGGCTCCATCCGAGAATCGAGACGCA
TTGGCAACCTGGACCACGAGCTCTGAGGCGCATAGCTTTCAGTGTAGGTGTAGTATTGAGCGAATTCTATTCACAAGTTGCAGGCAATACGACTTTATAA
CGGTTCTAAATCCTTTCTAATAGTAGTAAAGCGCTAATGCAAATATCGGCAGCGTTTGCTTGGACCCCACTGAAATGCCTATCTTGACAAGAATCCATTT
CTTCCTGAATCCCGGTTGGCACACACAAAGTCTCCGCCTGACGGCACGACAATGCACCCGTAGGGAATGCCACGGCACAGGAGCGATCAAGTATTTGTCG
CGACGACTTGTCAACGCGTTCTCGTTGTTCGCATGTCAGTCAGGATGACACAAATTTGGCGTAAGCTTATGGTGCATGTAGATTCTTCATACATGCAGTG
AATCGTAGGCGTAGCAACTGCCTGGTACATGCATGTGCTAGTTAACCCCAAGAGCGTTCTCCCAAAACAGGGGCCTTCCGAAGAAAATTACCATCAACAT
AGGAATGGTTTCTACCCTATTCATGACACACTGCATCGACGACCCCTCCTCGCTCCTCTGAGAGTGCTTAGACGGTGGGCCAGCCGCTGGAGAAGTCGAG
CTGGTTCCAACCGAATTTCTTGTCTCCATCCGCATACCTAATCCGGGTGTCCACTGCACCAAACAGTCAGGAAAGCCGTCAGTGATAATAGGACAACAAA
GGTAAATGAAGCGCGGCTTGCCGTAGTGGTAGTACAGCACGGGGCCGTACTTGGGGTCATTGTACACCCCCTGGCCTCCTGGTCCGTAGACGTAGCTATG
AGACTCGAGCACAACCGTGCCGCCGTTGTTCGTACAGTCGTTGCCGTTCTTGTCAACAAACCCGGACGTAGCATGCTTTGAGCGGCACACGAGGATACGG
TACTCCTTCCCCGTGGCAGGTCGTGACGTGTCGTAGCCACAGCAAGTGCCCTTCGAGAAGAAGAGATAGTAGTAGCCGTTGTACGAGAACATGTATGCAG
CCTCGACCACCTCGTAGTTGGATGTGAACGCCATTTGATACGCCGCTGCCCCACCGGTTTTCGTCGGAGTTGACTTCATCTTCACCTGGTAGATGTCCTG
CCAGTAGCTGCTGAAATTGAGGAAGTACTGGCTGCCAACCTGGAACAGGTTCGGATCGATGGCGTTGTACTTCTTAGACGAGTCGCTCGTGACGCCAATG
CTGCCAAGATCGGTCCACGAGCCTGCCTCCATTGTCGTGGACCGGGTGAGGCCGACGGCAGAATTTTGAGTTCCGAAGGAGCTCACCGAGTAGTACAAGT
AGTACAGGTCGCCAACCTTGTGCACGTCTGGGGCCTACAAAACAGAACGAGTGGGTCACTATCAGTAGGATAACATCCAGGGACAACGAACACACTCACC
CAGAGATCATCCTTGCCCGTCAAATTAATCTTCGAGCCAGTGGGCACTGCAGCTCCGAGATACGTCCATGGGCCCGTCAACGCCGGGGCCGAGTGGATGG
CGATCTTGTTGCCCGTGGAGAAGCGGAAATAGGTGCCATCATCGCGCCGAATAATGGACGGGTCGTGGGCGTTGGTGCAGGTTCCGGTGCACAGCTTGGG
GTTGGCATACCCGTTGACGAGACCAGCGCCGAGCAGTAGGAGAACGAGGATCGAGAACAGCTTCATGGCAAAAGAGTCGAGACGATCAGAATCGAAAGTG
CTATTATAACTACTGCACACCTAGGCGGCCGGTAGAGGACTCCGAGTTTGTACGCCGTGTGTGCCTCCATAGCAAAGAGAGGTTTTGCATGAGCTGTTAC
CAGCTGCATTGTTGGCGATCACGTCGTATGAAGGTGCCAAAAGCGTAGGATGTTTTGACCGGCATCCATGACGACGACACGCGCGAAGATTCATTGGGAG
ACCTGGGTCACCAGCAAGTTGCTGCTGGCAGCAACGGAGCAACTATCAAACTGCACTTCAACAAGCTTGAAGCATTTTTCTGTACGAATCCATTTGCTTT
GATGTGTGTTTCAAAAGGAAGACCACGATGTAGAGGTCAGGTCCAACACAAGGATGCTACAGTCTATTGCATCAAAAACGAACCGCACAAAGACACAAAG
GTGAGCCACGGTCATCACGACGAAGTTATCGCGATGTACGTCTTGAACGATGAGGCTGTTGGTATTGACTTAGTTGTTGAAACTGTACGACAGCGACTTT
TGCACGGCTACGGTGCCTACAGAAAACAAAATACATGTACATCTACTGGTAGTGTGTATGCGATGCTTCTTCACTCTAGCGCATCGCCACCTTAGTTGAG
CACGCCGATGCCGAAGTTGTTGGTGGTCTTGCTGTGCTTCTTCGCCGCGCTCGGACTGTAGCTGGAGATGGCCGAGTACGACTTTGCCGTGGATAGAGCC
GTCGCACCGTTGCGGGACTGAAACGCTCCGCTGTTGTCTACCACGTTGGCGGCGCAGGAGCGACCGAGGTAGCTGTTGCACTCGGTGGTGGCGGTGGCGG
CGTAGAGGGCGCCATCCGAGCCGGTCAGCAGCGGCAGCGTCGTGTCCTGGAAGTAGTTGCCCTCGGCGAGCACCCATGCGTTGACGCCGATCTCGAACGA
GTGGCCCGAGTTGTCCGCCCAGTAGTTGTTGGCGATGTGCGCGACGACGTTGGCGCTGCTGTCGCCACCGATCTTGGGCGAGCGTCCCGATGTTGAATGA
ACGTAGTTGTTGAGCATGCTGAAGCGGGTGTTCTTGCCGTAGAAGATGAAGGACCAGTAGTGGCGACCGTCACACGTAGCCGAGTAGTCCGTGCGGCCGT
CGAAGTCCGAGTTGCTGATGGTCATCGTGGACACACTGGCGGCGTTCGTCGTCAAGAACTGACGGCCGACGTGGGAGACCTTGATGTGGTCCAGCCAGAT
CTTGTTCATGGCCGTCGAGCCGCCGTTGCTGCCCTGCATGTAGAAGGCGTCGCCACCCCACACCAAGTGGCGGTTGAGCTCCGTGATGTGGATGTTTTGC
ACGATGATATTGTCGCCGTTCAGCCACAGACCCTTGCCCATGATGACACCGCTCGTGCCAATGCCGCGGATGGTCTTGCTGCCAGTCACCGTGAGTGGGG
TGATGGCTGCGTTGTCGTACGTGACCGTCACGCTGGTGCCGTCCGAGCAGCCACCCGTGTTGGACATGCCACCGCTCTGCAGGATGACATCCTGGCTCTT
GTAGCCATTGTTCTTGGCGATACACTCCCGGGTGTAGTCTGGGCGGCAACCAGCTTCGGTCGTCGTGCCCTCCGTGCCGCGGAAGTCGAACGTCTTGTTG
AGCACGATGACACGGGGCACGGCGTCCTTTAGGTACGCGACGAGCTGCGCCGTCGTGGTGGGGTACACGGGGGTGGCGCTGCCTCCGCCTGTGGTTCCGG
CAGCGAGACCGGTGGCCGATCCGACCGTGAAGGCGTCCGTGGCCTGGACCACGATAGCCACCACCACAATGAGAATGGGACGGAAGAACTGCATTATCGC
GAGTGTTTGGAGGTTCGTGAGCGGCGTGAAGCAAATTGGGGAATGACATGCTGGTGGCGGTGGCAGACTGCGGAGCTTGTTGTAGTGTCCCGCTGTTAGA
GAGGGTGCGGCTGCCCGAAGCGATCGTATCGGCACGGGCGAGGACGCCCTGATCGGGTTGCACACGCGCTGGGTGCATCTATTGAGCTCGGATGATCCAT
CTGCTTTATCGTGGATGTCATGCGACTAGCAAGACGGTATCCTGTTCGATTTCGCCATCTGCCACTCCGACATGGCGAAATGGAGAGACCAGGCGGCGGC
GTGCTGATGCACCGCTCGATTGAAGTGAGCGTAAAACTTGACGCCCCTAGGTGACCCCAACAAAAACACTATGGTTACAGCGGAGGGATATGCGGTTGGA
CCAGACAGTTGTGGCGTCGAGTTGCTTACCGGTACGTGTATGCAGGTGACATCGATGGTTTACACACATCCTAGGGTACCGATGTTTTATACAAGTTTTG
AATGCTGCGAGGATGTGGCACTCGAAATGCCCAAAGCTACGAAGGCATCCAGACTGGCGCAGGATGCAATCCACTGGGGGCAATCAACGTGCTTGGTTCG
TTGCATTCATCTTTGCAGCCCTTGTTCCAAATACACTGTATACACACAGTAGGGACTTCCCATGAAAACGAGTTGGGGTGCAGTGTGAACTGGCCATAAA
ACGGGTGTGGAGTTCTGCGTAGACCTCGGTGGCTTACGAGACGCTGCTCGGCTGCTTGCTTCCCAGAGCGTTGAGTAAATTCTACAATTTTCAGCACAAA
AGTGCAACGTTTACAAACTTCTACTCGACAACGAAACTACATGGCATGCAGTACATCTGTCTACAATGCCACCAGGTTACCTCTACTGGTAGCCAAAACG
TTTCGTTGTCCGTCGCGGCACGACTGTGAAGACCACCAACTACATCAATGTCTGTTGGCGGAACAGGTAGTAGTGTGACGGTCGGTAGTACCTACGACCT
GCCTCTATGGAAACCTTAGCTAGACGCAGCAGCATCCAGTGTGTGGTGGCTCAAGTCGAGCACCATCATCAAGTTGAGTGGCGTGCTTGAACTTGGACGA
TCAGCAATGGTAGGTAGGGGCGTGAAACATTCATTGATTTAGTTCAGTTCACAATAAGCAACCCAGCGAGCAATACACTCATTGACCGTTATTTACCTAA
AAAACGTTAAATTGGTGTTCCTATCGCCATGTTGGGAATAGTACCAAAACCTTAATTCGTAAGTCCTCGGTGACCCCATTCAGCCTTCAAAAATAGCATT
CTCGTCTTCGTGACCTTGTCTGCGTCGTCCCTGCCCACCTATGTAGCCTATCTGCGTTGTTGATGCCCTGCTAAAGTGTTTCATGCCTCACCAATCAACA
CCGTATTCTCAAATAGTCTCCCCAGTCACTACAAGCCCCCGCAACCCTCCGCTTAACCTCTCAAGCCTCCGCTCCTCGCTTCTCGTGCTGCTACACATAT
TGAAGCC