Description :
From Genome Similarity Track
Location :
Scaffold_1524:1165- 5593
Transcript NameFunction/comments
Phypl_g13616hypothetical protein

Sequence
4428 bases(100 bases per row)
ATGACCTTCCTCCGGCGGGTGAATACGATCCGGATGGCTTGAGTATCGGTAGACCTCGACGTGCTGTGGCGGCGACCGCAGAAGCAACGACCGGGGGCGC
CACTTCGGCCGCACGAATCCGAGTGTCAGCGATCTCGGAACTTAAGGAATTCTCGGGGAtggacaacgacgaagatcgcgccagcagctggctCGGCAAA
GTCAAGTCGGCGTTCATCCGTGATCAGGTTCCAGATAGCGAGAAGTGCTTGGTCTTCGGCGATCTGCTCACGGGACCAGCCCGCAACTGGTACCGGCAGT
TGAGTCGGACGACGCGAAGCAGGTGGAAGAGTCTGTTCGATGACTTCCTGATCCAGTATTGCGGACGTGGAGTGTCTGTCGCGAGACAGTACTACCACGC
GAGGAAGCGATCCGAGGAATTACCGCTCGAGTATCTACACCGACTGAACGTTGCTGGATTGCGAGCAAAGCTCCCGATCAAGGATGGATCGCCGGACGCC
CGGCGAGAACACGTCGAACACTTCATCGAGACGTTTGACGATCGTGACCTGGCGGATCAGCTGGCGCTACTGATGATCGCCGAAGCGGGCCATCTCGAAA
ATACGCTGCGTGCGCGCCAGCGCGCCAAGACCCGCCAAGGAAAGGCAGCAGTCGGATCGAGTAAGTTCCGCCAGAACgctgcatcgccagcacATCTGGC
TCCCTCGAAACCTGCTCGCGCGGTCCGAGCGATACAATCGAAGGAAAACCTCAGCAAGTCCGAGTCGGAAGCCAGCGGATCACAACCAGAAGGCGATCTG
CGCCCGATCTACCTCCCCCCATTCCGATCGTCAGGAACAAGGCAACTGGCAGCCACCACGCCCAGGCGTGCGGGACCGCAGGATCGACTGGACCCGAGCT
TCCAGGCGAAACAATGTTCCCACTGTGGATCCAGGAAGCATGACGACTTGAATTGCTGGAAGAAACTGACTTGTGAGAAGTGCGGCAGGAAGAGGCATCC
GTTGGACCCTTGCCTCTTCATGTGTCGGGCCTGCGGCGAACTGCACGATGCCAGCAAGTGCCCGATGGAGGAGTTCTACAACTTGATCCGCCAGTGGTAC
AACCCCAGCAAGCATGCCGGGATGTTGCCAGTCAACGCGGAGAAGATGTTAAACTAGGACGCTCGTCGGGTATGAATCCGATACGAGCCGAGCGTTCTAG
ATATTGCATATTTGCATTCACGGACAAGACATCGGTGGATCAAGTTAGCAAGCGACCCGATCGACACGATAATACATGTGAACTGCATGGGAAACGTACC
GTGGCGATCTCAAGCCTGCGGCTGGACGATGAGTTCTCCAGGTCCGATGTCACGGTAGCCTTGGATCTCCAACTCGGGGAACAACGAGGTTACTGAAAGC
AGCGGGACCCAGAGCAGTGGTTCGCCCCTGCCAAGAAGGAAGACACGTCGGGAAGTCCAAGTATCCTGCAGGTCAAGACGGCTTGGCCATGTGGGGGCGG
GGCGCTTCCCGATCTGCAGCCCGGAGAATCGCGAAGGTACTGGAAATATCATGCCCCTGGGAAGTGGTTCAAGCAAGCCAAAGCTGGCGCCAAGGTGAAC
AACGAGAAGGCCAAGTTGCTCTTCGACACCGGCGCTGAAGTCTCGATCATAGACACTACCTTTGCTCGTAAGGTTGGGTGTGTCATAGACGAATGTCAGA
GACAAGAATGTGTCGGGATCGGAGAGAACACATATATGACGGTTGGACGTACCACGATCAAGGCCACGTTGGCTGGATCGATGGTGTACTACTTCGACAC
TTGGGTTGGCGGTCAGTCGGGGCAGGAATCGATACTCGGCATGGACTTCACGGTACCAGCCGGAGTCCGCCTCGATTTAGCAGATGGGACGTTCTGTCTC
CCTGATGAGGTTCGGATTCAGCTGCTAGGACGGCGTCCGCTGTACGGGTCCAGCAAGATCTTGCTTGACCAAGATCTCGAAGTGCCAGTTGCCGAGTCCG
TGGAGGTCCCGATCCGATGCGGCAGATCGGCTAGCGCGAAGCTCTGGATCACACGGGGTTCAAGATGGGTTCCGACCGCTATCAGGGGCCTGTGTAGAAC
GAGGTATCTCCAGATCACAAACGTGAGCGAAGAGAAGTTAGTGCTCGATCGGCACGCACGACTAGGAATTTGGTTAGCCCCAGACGCCGTACCTCGCATG
CCCGGTTTTATGTCAGTCGGATCGCGCAGGTACGCTGAATGGCAGAACCTCGCGTTCGAGGCTACCACTGAACGACTGGAGGAGCCAGTATCCGAAGAGG
AGCCAGTGGGACCGCTGGTAGATCGGCCTCGATatccgacgccgacgcaAATTCTGAGTCGATCGGATGGGGCTCTCAAACCAGTGGTGGCCGTAGCGAC
CACCTTACCATCGCCCTGCGAAGGAACACGGGAAGGCCCGCCGGAAGCCGAGATGAAGCGCGAAGAGCcggacgaagagcgagttGCCCGGGAGCCTGCA
CCGATCCGAAAGGAGGAGTCGACCGAGCCAAGCCAGGATTTGCCGAAGACCGATGTCGATCCTTAACGGGAGTCGATCTCGGATGAAGCTAAGGCAGAAC
AAGTCTGCTAccacgaaggaggaggcttGTTTGCAGAAGATCTCGAACAGAACTTGGTCATCTTGCCCGAGGTAGCAGCTTCAACCGAAGAAGTAACGAT
CGAGGACATTCAGGTTGGCGACCCCGCTCTGAATACCCCGGAAGAGATCGACCGGCTGCGACGGATCATctggcgaaggcggcacTTGCTGATCGGAAAA
GGGAACGCCcagccacctgcagcacgcggtgcaGTTTGCGACATCGACGTTGGTGGTGCCACTCCAGTAGCCCAGCGTGTGCGACCAGTTGCTCCACAAT
TTCGAGAGAAGTTGGCTGCGCTGATCAAGGGTTTGCTGTCGGCCAGGATCATCAAACACTCGACCTCACCGTGGGCATCCCCGATCGTGATCATCATCAA
GCAGAACGGTGTTGATATACGACTCTGCATTGATTACAGAgtcgtcagcagcttgacgcgcttgaTGGTGTATCCGATGCCGTCGATCAACAATCTCCTG
GAAGACTTGGATAAGATCTTGTGGTACTGCCCCCTTGACATGGCGAGCGGATTCTGGGTGGTCTCCATGACTGAGAGTGCACGGTTGATCTCAGCGTTCA
TCACTCCGTTCGGGCTGTTCGAGTGGCTGGGTAAACCATTCGGACTGAAGAACGCGCCTCAAATCTATCAACGGCTTATCGACAATGCTTTGTACGGACA
CTTGAAGATCAGCGCGGATCCAGACTTGAAGGAGACGAGTGACGTCTTCGAGGAGGGCAAACCTGACACCGATCAGAAGCCGTCCGTCCTGGGGCGTCGA
TCgtacatcgacgacatcttAGTGACGGCCGAGTCTTAGGACACCCTCTGAGCGAAGGTCGATCATCTGTTGGAGGCTTGCGAACAGTGGAACCTCTCGA
TCAGTGTCGTCAAGAGTGTCTGGGGACGCTGGAAGGTCGATTACCTGGGTCATCAGGTGTCAGCGGGTGGACTAGAAGCCCATCCGAAGGATCTCGATTC
CCTGGTCAATCTCCCGTTCCCACGTACGCTACGATCGATGCAGTCTATCTTGGGCAGCTTGAACTACTATAGCCGCTTCATTGAAGATTTCCCGATCTAC
GCTGTGATCTTGTACGAGCTGCGAGAGGTGGATTTCTATGAATTCCGTAGACGAGCAGACGGCGCAGCTGGGAATAGTGACTGGGGGCGCCCGATCATCT
CCTGAAGAGGAAAGAGGGCGATCGCTGGGTGAGAGCCACGATCACGTTCACTCTGCTGAAGGCGGAGATCGGTTCTACGCCGATTCTCCGTCACTTCGAC
CCGGATCGGACTCCAGTCGTAGTGGTATACGCCAGCAGATGGGCGATcgccgcggcgctgatgCAGGACCGTGACGGCGTGTACTGGCAGGTGCCTTTTT
CACTAGCCGTACCTTGAAGGCGAACGAGATCAACTACGGGAAGGTCGACAAAGAAGTGTTGGCTCTCCTCCGTGTCTTGAACGGCTGCTACACGTTGCTC
GTGACGCGATCGACCAAGGTGTTGACTCGTCACTCGACGCTGGCATGGCTGGCGAACTCTTCTGGACTGGACGGCAGACTCGGTCGCTGGGCTGCGTTCC
TTTCCGAATGGACGCTTGAGATTCGAAAGCGTGCGAAAGGAGCAGACAAAATCCTTGGCACGATCGCGGCAAGCATCAAGCCTCGATTTGAAGTCGATGA
GACGTTGGTCGCAATCGCGCCGAAGAAACAGCCACGTCAGGTGGTCAccatgctgccgccgacaGTCGAGCTGAATGAGAGTCTGCTAGTCGTCAGCTCC
GATGGATCTGCGAGCGTCAAGCGAAAGG