Description :
From Genome Similarity Track
Location :
Scaffold_1913:1165- 4284
Transcript NameFunction/comments
Phyta_totarag13856hypothetical protein

Sequence
3119 bases(100 bases per row)
AACAGGTTGACATGGATGGTGTCTTCTGAAAGCAACTCGGGGTCAAAGAACAGCGCATGCCAGCGCTGACGAATCGGAGAAATGACTTTGTTCACGAAGA
AATCCTGTGCCGCTTTTGTCTCGTTAAATGGAATGCATGTAGAACCTTGgggcagcgagctgctcagTCTGCAGCATACAAACCAACATTTTAGTACGTT
AAACTAGTGATCCAGCCTCCATAACCatccttgctgctgcgcttaCTTTTCGTAATTGATGTAGACCTGAAGCTGGTTGGGATCTATCAACATACCACAC
CACGATATGCACCCCTCCGACTCTGATGCTGCGGATTCCATACCCTGTTCCCCTCCATTGGCGACCTCGAAATTTGCTTGACTCTTGGCCAAATTTACGA
AACATCCGTATTCCTCATTGCCCTCGTGCATCACCTCGAAGAACTTCCGTGCTCTCTTCAGGTCCGTCGTAACGTACATGAAGTCGTCAGTATAGCGAAA
CAGCTCTTCGTGTTGACAGCAGGACAGAGGCACAATGGCCGGGTCACATACTTCAGGCAAACGCTTGCGAAGTACTCGCCGCTCAAAATGAGCATAATAT
ATGTTGCACAATGTCGTGGAGAGCACGGAACCTTGCGGGATACCACATCGCTGAACGTATTCGCGACCATCGATCTGGATGGCATTCGCGGATAAATGCT
CCTTCAACAACTGGAGTGCTTTCGTTTTAGTCAGGTAGTCATAAAGAACGCCATCCACAAACATCGAGTTCATCTTAGTGGACTGAGCTGCAAGTTCGTC
AAAGCCCAGAAATTCACCAGACGGGTACGCCAGGCGCTCCAGCTTAAAGAAAAACGAAGACGGCGGCAATGATTCGTCACTATCTGCAGAAGATGACATC
GGGGCGACTTGATGACCAACCCAATGTTTGCGGATAAGATATTCATCTTCTTGTACCGCTTTCTTGAGCATCTGGTAGAGCTTTCGCGGTCGAATCGTAT
CGAAACAGCGCTCAACGTCAACAGCTACACAGTAAGCCATTGGGGTGTCTCCAGAAGCACGCTGCCGCTCTGCACAACGTTGACATGAAGAAATCTGACG
AAATAGAGGCTTGAGCCGCTTGTAGATTTCATCGATATTTCGGACTGATGCTCCAACAAGCTTAAGCTGCCGCTCCATCTCAAAAGTCAGTACTCGATGA
ACAGCTTCCATAGACCTGTTCACTGAGACCTTGGTTTGATCTACGGCTGTGGATAGATTCATTAGTGGTCGAATCCCGGTAGCTTTTGGTAGCAATCGCA
GTCGAGAGATAGCTAGCTGGCGTTCGAGGTTGCTTGGCAAGATTTGGTCGCTAGAAGGTCTCAGAATTCCTCCTTCCAAGTCATCGAGAGCAagcgtgct
gcagcataACAAAATAGTTATTAGAAGTGGCATTACAAGTTTCACAGCGATATGTCTGGTCACCTGATCACATTCCAAACTGGCCGCTGGTAGTACGCGA
TTTCGTTCGCCATTCCTTCTGCCTCAGTAATATAAAACAGGTTTTGCAATAATGGGAAGACCAACAATGACATCACCCACCATAGCAAGTCCTCGAAGAG
CTTCTGACGCTTGATTAGTTCGTTTGGTGGGCTTAATGGCACAAGAAACAAAGCAAGTAGATTAGCTAGAGTGTTTTCAGACTGAATGAAAATGAGCACA
GTACCAGAACTTTGCATTCTTTTGCACATTCATCCATTCCACCTTGGTCACCTGAAGCTCTGCCGCACACTGCACAAAAGACACCGTCAGCACAAACGCC
ATTTTTAAGCTTCAATCTTTGAGGTGCCAGGGCTTGCCTTTTTCAGCGAGAAGATATCGAACTTCCGAGAAAATATAAGTTTacgcagcaacatcttcac
GGACTTCCAGTTTTTCTttgtgtcgctgctgccccACAGTTCTTTCGGTACAACTCTAGCAACGAACTTACGGACCAGCCGATaaatcttcttcttcggc
gacGCAAATTCCAGCAACTTTTTAATATCCTCCTTGTGTTGTTGTAACTTCGTCAGGTCTGACGGCCCATGGGTGTTACGCTCCTTTCCACTGGCGGCAT
CTGCATTCTTCTGTTTCTTTTTAGTGTACGCAGACTCACTGTGACCGTTTTTCGATGAACCCGCTGATGTATGGGTCAACATTTCAATCGCTTCCTCTCT
CCGTTTCCGTTTACGATCCGAGCTCGGTGCCACAACTTCACTTTGGGTCAAATATCCGTCATCCAGCGCTTTGCGTACGATTGGAAAGAGAATGGGCTGT
GAAGATGTATTCGTTTCGGCAGCCCTCTCTGAAATTTTACGCGTAATGCTCGGGTTATCCGCCATAAACTTGCGGAAATCACCGTTCACTGGGGTAAGTT
TCTTTGCAAACTCTTCGACTTGGAATGCTTTGAATCTCGATACCATAGCTTGTATCGTAGGAATCAGATTGATCAACCGCTTTGGTAAACGCGTTTGACC
TATAGAATCGGGAAAAATTGATCGAAGTATTCGAGACGCTTCTGTCCGACTAATCGGATCGCCTGTTTTGGATGCCTTCACCAAAACATGTGAGCTCGCG
AACACTCGATCTTTTTGGAAATAACGCGCATACATCACGCGGTTAATTGACACTTCTCGCTTTGCACTGTCAACAGAAGCATCCGATGCTTCTCGCTTct
gctgacgaagacttTTTCCAGTGAGCTGGTAAGTAAACCCAAGCAACACACACACCAGACATCAGACTCATTCCCAGGTTCACATGGACTCCTTCAGTGC
AAATAAGTAACTAACTACCTGCATGTACGAGCCCAACGCTTCCTTTAATTGCACAAAAATCGTATaattcagcagcaggtgcgtCATGAGATCGTCCCCC
ATGAGTTCATGTAAAGACCCCCAAAGCGGCTTTTTCAGCGCAGCCACCAGCGTGTTCGGGTAGTAGCACGTGATCCCGTTCGACTGCGTCACTCGATGAC
CCGCAGCCCCCGGCGTGACTTCCCGATACCCAAGCGTCAGAATGTTTGCGTCCTCCCAATTCATCACTCGTTTGCGAGCCAGGAGCCGATCAATGACATG
ATGCACCAACTCCGTCTGT