Description :
From Genome Similarity Track
Location :
scaffold_1786:1165- 2797
Transcript NameFunction/comments
Pl_100340hypothetical protein PHYSODRAFT_295070

Sequence
1632 bases(100 bases per row)
AGTACCACGGGAGCTAGCCTTTCGGGGCATGCTTGGAGGTGGCTGACGTGGAAACCATGTGCTTAGATGCGCAAAGGCAAATGAATGCCGCGAGGGCCAC
TACGGTGGCTGATCGATGGCAATCGACCGAGAAGGAAAGAGATTGGGAATCTCTTTCCGACTCTCCATCGGCTGGATGGCTCCAGTCTAAGTGAGGGAGG
ATGTAACGGGGTTACGTAAGGGTGACCCAATGAATGGGTACACCCGTGTGAAGTGGGCAACTTCACGTATCCACTTAAGGGATACTTTGGATCAGTAGTG
TACATCACACCACTGACACCAGCCAGGGAGGCTGAGAGCCAACCAATGAGGTTTGGCCAAGTTTATATAGATCAAACTATAGTTGATTACAGATTTGTAT
TACAGGCCAAGTTTAAGGTAATTAACTATAAATATATTCAGTCTTAAATCTACCCTATTCTAGCTAAGTTCAGCTAATCTATGAACCAAACTATAATCAT
TCTATCTATCAAACTACATTCATTCTATGAATCAAACTATATTCAGTCTTAATTCTAGCTATTAAGTCTCTAGGATCATTAATCAGAGCCTTCCAAAAAT
TCAACCAGAGTAGAAAATAACTCCGAAAATAACTCCCCGAATTCACGTTTGAAATTACACTTGTTTTCAGTATGCCGAGTGAACCCCACCAAAGTTTCCG
AGCCAGTGGTGGGATTCACTCGGCATACTGAAAACAAGTGTAAATATATGTGGTTTCATTGGCCCATACTACAAGACTACGTTTAGCTAAAAAGAGGGTG
ACAGTCGTTTTTATTGGTCAAAACCATCGAGCTCGAGTGTTGCTTGAGTGTTGTTTGAGCGCTTGACGTGCTCACGCAGTTTTGACCAACCAAAAACTTC
GCCAACGGAGTTTTGACCAATCAAAAACTCCGGCAACGATTCCGAGCCAACGCTGTTTGAAGCCTGCCGGAGATTTTGATTGGTCAAAACTAAAACCTAG
CTTTTATGCTAAAAATTAAATTATTTGAGGATCCCACTGCCTCATTGAGTCCAAAACCCCTCAAATGGTGTGCACACCAGTTCTGTTGCCTCTGCTGCAC
GCTCGAGCATGAACGAGATGACCGACTAGCTAATTAGTCCCCTAAGACCGGGGTCTCGTGAACTGCTACGGAGTTTGTATACTCCTGATAGCACGCTTCC
TCAAAGCAAGGTGCTCGTGTGACCCCGTCACAACGCTACTATTGGAACAGCTGATCCGTTTGGCACAACATGCCTACCGTGTACTGCTTCAGAGTTCGGC
CGTGTTACTACCACCCTTCATGGGCTGAATTTTCATCCATGGACTCAATATATCATTGCTGTTCGTGGTGCTGGTAATGCGTTGCCCATTGCAGAACTAT
ATGTGCCCAGAGCTTGCACGTATATGTTGGAGCCTGCAGTCATTCAGCATCCAAACGGTTTGTGGAATTCTTGAAGAAGAACTATGCGTCAGCGATTCAT
CTTTCTTTTTATCGTGATTATTAACGTGAAGATGATTTTCCCCAATAATGTTTGTCTTCGATTTGCTTCAATGTAGCTACTCCTCTAGCTACTCCTCTAG
CACGTTTCGCGCCTGTGCGTCCCCCGCTGAGC