Description :
From Genome Similarity Track
Location :
contig_29:116492- 118810
Transcript NameFunction/comments
g6749.t1XP_002902049.1 conserved hypothetical protein [Phytophthora infestans T30-4

Sequence
2318 bases(100 bases per row)
GCGTGGTCTCAGACCACTGGTCTCTGCTTGGATTGGACCCGCGGATGTGCTGGAGCGTACCGCGCAAGGAAGGGGGCCGCGCGGCAGATGGAGGCGCGCA
AACTCAAGTGTCTTGACCTGGTTGAGTCACCTGCCACGCTCGCCATCAAGCGGCAGTTGGGCTTGCTCGCCAGTTGCACCGCGGAATTGGACGGCTTTAC
TTGCAGAGTCTCCGCTACATACACCCGAGATATCAGAATGAGCGAACACTGCGAAGTGTCTTTCGTCCTCGTGTCCGTCGACACGCGTCGACAATTGAGC
CACATGAGCCGAGCCATTGGTGGAGAGGGAGCAGCTGATCACCGCCGCCCGCGGTCTGCCACAAATCCTGTCGTGTCAGCTTTGAAGGTGCCTGAAGCGA
GCTCCGATCATAGGAAAGATCCCTCATCCACCTCACTGCTGCAGAGAGCAGGACCTTCGAGCTGGGACCAAGAACAAGAACTGCAGTCAGGCAGGGTGAA
CAGACAGCGCAGCAGTGATTAGAGTTTGCAGCGCTGGACGAACCAAGCAACTTCAACATCCGTTATCGAGCACCGGCACCAGTAACGGTAAACTTAAGTT
TTTTAGTGCATGCGCGTTCTGCTTGAGTCCTCCTCAATGTATTGCAGCGGGCGTCCTCGTCGCCGGCAGCCAACGCGGTAGCGCGCTATCGGAGCTGCAC
CATTAGCTTCATCATATTGTAGGCAGGAGTTCACAACTTCAGCCACAACTTCAGTCTTCAGACTGTAGCCATCTGCTCGGATGAGTTCACGCCAAACAAT
CATTTTTTGTATGAACTGGAACTGGAATTCAGAAGGCCTTGTCGCTCGCTACCTGGTGGCTGTCCCAGCAGCATGTCTTCTGCGAGAAGCAGACTCACAC
ATCAGTAGCAGGCGATTGACATCCCGACCGCCACGGGGTAAGGAAAAAATAACCCATCAGATTTTAGACGTTCTAAATGATGTCCTTATTTATCAGTCCG
CACACTAATAAGGTCCATGGAATCACACACTTCGTGTAGCTTATTATCTTAGTCGCGATATACTGCTCGCCGGTTATCAGTCGGGTGTATGCCATTGCAA
CCTCCAGAGCTGCGATGAGGTCCTGTTTTTCATCCGTGAAGCGTGCTGGAGAGGTCGCAAGACGCGCAGTCCATTATTCAGGCGAGTCACGGTACTCTCA
CATAATTTGGAATTGAATGCCACAACTTGATTACGGCTCTGGGTTGACTTCGCATTCCATTCAGCGTGCTGGATCTCACTTCAGTTTTGCCGACTTCCAG
GGCGGAATCATCATGGTGAAGGTCGGCGAGGACGAGGACGAGGGAGACCAGGGCCTGACGACCAAGGACCAGAAGGCGACAACAGCAGCTGCTGCAAACC
CCATGAGTCCGCTCTCCTCGGAGGCGCTGATGCTGCGCGAGCTGGAGCTGGCGCCCGTCCTCATGTACCCGCAGCAGGTCTCGCGCGCCACCGAGATCCG
CCTCTTCCTCTCGCGCATCGAGTGCATCGCCATCCACCAGGTCATCGAGCGCGAGGAGGGCGTCGTCTACTTTGTGCTGGATGTGTACCGCTACCGCCTG
CAAAAGGGGCTCCCGTGCACGCGCAGCCGCCGCCGCAAACTGTCGGCAGACCGCGAGCCCGAGGACCGCGGCCCAGGACTACCAGATCGAGCAGCGCTAC
TCGAGCTTCGCGCGTCTGCGCTCCAACGTGGCGCACATTGCGCGCAAGCGCCACCCCAAGGGCAAGGCGTGCGGCTACTGTTCAGGCCTGCTGGATTTCC
TGCACGTGACGCCGTGCAAACCTAGTCTCAAGGTCAAGTTCACGACCACCACCGAGGAGCGCAAGGGCATCCTCAGTAACTTCATCAACGAGCTGGTACA
CGTCGCGCGAGAGGACTACGCGTCGTGTCCGCGGTCGCTGCGTGGCTACCACATTATCCCTGCGCTCATCAAGCGCTTCTTGTCGGAGCAGACTGGCGAG
TCGTTCTTCACGTGAGAACGGGCATAGGTAGGTTGCAGATGAAGTGGAAAGAGGCTTTGCAAGGACGGACGAAGGAGCAGGAAGAAGAAGAGATGTGAAT
TATGAACAGGTTTTGATATTTAAAACAACCAAGCGCGCATGAACACTCCGCCGTGGCAAACGCCAACTCGAGCGACTCCATTTTGACGAGATTTGTGCTC
AGTCAACGCTGTGCCTAACTTCCAGCACATCTTTCGCTATTGGTTAAAACTACTTTCCAGTCTTCCCATTGGCTTCTGCCTCGTGATATTTCTACTCGAC
ATTTTTTTGCTGCCACGC