Description :
From Genome Similarity Track
Location :
contig_29:116490- 118808
Transcript NameFunction/comments
g7067.t1RAW26108.1 hypothetical protein PC110_g17482 [Phytophthora cactorum

Sequence
2318 bases(100 bases per row)
GCGCTCGCGTGGTCTCAGACCACTGGTCTCTGCTTGGATTGGACCCGCGGATGTGCTGGAGCGTACCGCGCAAGGAAGGGGGCCGCGCGGCAGATGGAGG
CGCGCAAACTCAAGTGTCTTGACCTGGTTGAGTCACCTGCCACGCTCGCCATCAAGCGGCAGTTGGGCTTGCTCGCCAGTTGCACCGCGGAATTGGACGG
CTTTACTTGCAGAGTCTCCGCTACATACACCCGAGATATCAGAATGAGCGAACACTGCGAAGTGTCTTTCGTCCTCGTGTCCGTCGACACGCGTCGACAA
TTGAGCCACATGAGCCGAGCCATTGGTGGAGAGGGAGCAGCTGATCACCGCCGCCCGCGGTCTGCCACAAATCCTGTCGTGTCAGCTTTGAAGGTGCCTG
AAGCGAGCTCCGATCATAGGAAAGATCCCTCATCCACCTCACTGCTGCAGAGAGCAGGACCTTCGAGCTGGGACCAAGAACAAGAACTGCAGTCAGGCAG
GGTGAACAGACAGCGCAGCAGTGATTAGAGTTTGCAGCGCTGGACGAACCAAGCAACTTCAACATCCGTTATCGAGCACCGGCACCAGTAACGGTAAACT
TAAGTTTTTTAGTGCATGCGCGTTCTGCTTGAGTCCTCCTCAATGTATTGCAGCGGGCGTCCTCGTCGCCGGCAGCCAACGCGGTAGCGCGCTATCGGAG
CTGCACCATTAGCTTCATCATATTGTAGGCAGGAGTTCACAACTTCAGCCACAACTTCAGTCTTCAGACTGTAGCCATCTGCTCGGATGAGTTCACGCCA
AACAATCATTTTTTGTATGAACTGGAACTGGAATTCAGAAGGCCTTGTCGCTCGCTACCTGGTGGCTGTCCCAGCAGCATGTCTTCTGCGAGAAACAGAC
TCACACATCAGTAGCAGGCGATTGACATCCCGACCGCCACGGGGTAAGGAAAAAATAACCCATCAGATTTTAGACGTTCTAAATGATGTCCTTATTTATC
AGTCCGCGCACTAATAAGGTCCATGGAATCACACACTTCGTGTAGCTTATTATCTTAGTCGCGATATACTGCTCGCCGGTTATCAGTCGGGTGTATGCCA
TTGCAACCTCCAGAGCTGCGATGAGGTCCTGTTTTTCATCCGTGAAGCGTGCTGGAGAGGTCGCAAGACGCGCAGTCCATTATTCAGGCGAGTCACGGTA
CTCTTACATAATTTGGAATTGAATGCCACAACTTGATTACGGCTCTGGGTTGACTTCGCATTCCATTCAGCGTGCTGGATCTCACTTCAGTTTTGCCGAC
TTCCAGGGCGGAATCACCATGGCGAAGGTCGGCGAGGACGAAGACGAGGGAGACCAGGGCCTGACGACCAAGGACCAGAAGGCGACAACAGCAGCTGCTG
CAAACCCCATGAGTCCGCTCTCCTCGGAGGCGCTGATGCTGCGCGAGCTGGAGCTGGCGCCCGTCCTCATGTACCCGCAGCAGGTCTCGCGCGCCACCGA
GATCCGCCTCTTCCTCTCGCGCATCGAGTGCATCGCCATCCACCAGGTCATCGAGCGCGAGGAGGGCGTCGTCTACTTTGTGCTGGATGTGTACCGCTAC
CGCCTGCAAAAGGGGCTCCCGTGCACGCGCAGCCGCCGCCGCAAACTGTCGGCAGACCGCGAGCCCGAGGACCGCGGCCCAGGACTACCAGATCGAGCAG
CGCTACTCGAGCTTCGCGCGTCTGCGCTCCAACGTGGCGCACATTGCGCGCAAGCGCCACCCCAAGGGCAAGGCGTGCGGCTACTGTTCAGGCCTGCTGG
ATTTCCTGCACGTGACGCCGTGCAAACCTAGTCTCAAGGTCAAGTTCACGACCACCACCGAGGAGCGCAAGGGCATCCTCAGTAACTTCATCAACGAGCT
GGTACACGTCGCGCGAGAGGACTACGCGTCGTGTCCGCGGTCGCTGCGTGGCTACCACATTATCCCTGCGCTCATCAAGCGCTTCTTGTCGGAGCAGACT
GGCGAGTCGTTCTTCACGTGAGAACGGGCATAGGTAGGTTGCAGATGAAGTGGAAAGAGGCTTTGCAAGGACGGACGAAGGAGCAGGAAGAAGAAGAGAT
GTGAATTATGAACAGGTTTTGATATTTAAAACAACCAAGCGCGCATGAACACTCCGCCGCGGCAAACGCCAACTCGAGCGACTCCATTTTGACGAGATTT
GTGCTCAGTCAACGCTGTGCCTAACTTCCAGCACATCTTTCGCTATTGGTTAAAACTACTTTCCAGTCTTCCCATTGGCTTCTGCCTCGTGATATTTCCA
CTCGACATTTTTTTGCTG