Description :
From Genome Similarity Track
Location :
Scaffold_116:11649- 12757
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_116-snap-gene-0.20Inositol-3,4-bisphosphate 4-phosphatase

Sequence
1108 bases(100 bases per row)
ATCTACGAGTCTCGCGCGGTCACAGACGTCACGATGTCCTGGATCGTGCACATGGGCGGTCTGTAGATCTCGGGCAGCAACTTTCGCTGAATCGAGTTGA
ACGAGTACTTGTAGCGCCCCACATTCTTTTTGGCGATTTCCATGCGCACGCCAAACTCACGCATGATGTTGGCGACGTTCTTGACTTCCTCCAAGGGTCC
GTACTCCGTCGCGCCGCCCATTTCAATTTCTTCCAGCACGTGGCGCTTCCGCTGCACCACCAGCCGTGCTTGCTCAAGTGTGGCGCTCATCGCCGTACGA
TCCTTGCCGGACTTGCAGTACGTGACGCGGCCGCCGTGCAAACTTCTCACGGCATCACTCGCATGCAACAAGATGCACGTGTTCTTCGACGACGAGCTCT
CGGTTTCGACGCTCACACGCAAATTGCGCAGGATCTCGTCGGGATGCGAGCCCACGCTGGTCTCGGACGTGGCCACACCGCACGCCGTAAAGCGATTGTA
GTACTCGACGATGGAGCGGAGACTTGTGCTGTTGATCTTGGACTGAATGGAGACGCCGGAGTGGCCCACCATGTTCGCCAGACTCTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNATTGATGCCTTGCGTGAACAGCACCGAGGTCACAGTGATCAACTCACCTTGGCGCAGTGATTCGGGCAGCAGTGCGAACTCA
GCACTGGGAACTGGGACGCGGATTGTGTAGCCAATATGCTCGCGCTTCTCGAGCACGACATCCGTCAGGTTGCTTTCAAACAACTGGAACGCGAATGTCT
CGAGACATTTAATCGCCACCCACGCGTCCGAGAGCATGCGCAGCTCTTTGCCGTGCGAGGAGATGAGACTCTCCCACCCGATCAGGAAACCCACCTTGGC
CATTTGCTCCAACACCTTAATATTCTTCTCTTGCAGACACAGGTCGAGCTCTGTGACAAAGCACGTGACGAGGCCACTCACGGACTGCGAGACCGCGACA
CTTTTCCGCAGGTAATACTCCGTGCGCAGCATCTCCAAGCGACACAGTACGCGTACTGCGTAGTTGATGGAGGTCGTCGGGTCGATGCCATCTTCCGCTT
CGGTGCGC