Description :
From Genome Similarity Track
Location :
contig_1:116436- 117633
Transcript NameFunction/comments
g30.t1hypothetical protein

Sequence
1197 bases(100 bases per row)
AGCGGAAGTACGTGCCATCATCGCGACGGATAATGGACGGATCGTGGGCATTGGTACAGGTGCCGGTGCACGTTAGAGGATTGGTGTATCCGTTGACGAG
GCCAGCAACGAGGAGAGGAAGTCCGACGAGAATAGAGAGCACCTTCATGCTTTTAAGTAGGCACGGCTTCGTTATTGGTGCTGTCAAAATTGAAAGTGAA
GAGCTCTTCTTGTTGGGCCGTTGACACGCCACACCGTTCGAACAGCACAGTCCACCATCAGGCTGTGCCTTTACCGTTGTGTTGACTTTTCACCGACGTT
TCGTATGTTCTGACTGTGGCGTGGCGTACCCGCCAGATGAATCTAGGGTCCCGGCTGGGATTAGCATTGTATGGATTTGCTGGAAGTGCTCAAGCCTTGA
GTCAAGGACCCAAACGTATCAAGTGTATGGTAAACATTATCGGCTCCATCCGAGAATCGAGACGCATTGGCAACCTGGACCACGAGCTCTGAGGCGCATA
GCTTTCAGTGTAGGTGTAGTATTGAGCGAATTCTATTCACAAGTTGCAGGCAATACGACTTTATAACGGTTCTAAATCCTTTCTAATAGTAGTAAAGCGC
TAATGCAAATATCGGCAGCGTTTGCTTGGACCCCACTGAAATGCCTATCTTGACAAGAATCCATTTCTTCCTGAATCCCGGTTGGCACACACAAAGTCTC
CGCCTGACGGCACGACAATGCACCCGTAGGGAATGCCACGGCACAGGAGCGATCAAGTATTTGTCGCGACGACTTGTCAACGCGTTCTCGTTGTTCGCAT
GTCAGTCAGGATGACACAAATTTGGCGTAAGCTTATGGTGCATGTAGATTCTTCATACATGCAGTGAATCGTAGGCGTAGCAACTGCCTGGTACATGCAT
GTGCTAGTTAACCCCAAGAGCGTTCTCCCAAAACAGGGGCCTTCCGAAGAAAATTACCATCAACATAGGAATGGTTTCTACCCTATTCATGACACACTGC
ATCGACGACCCCTCCTCGCTCCTCTGAGAGTGCTTAGACGGTGGGCCAGCCGCTGGAGAAGTCGAGCTGGTTCCAACCGAATTTCTTGTCTCCATCCGCA
TACCTAATCCGGGTGTCCACTGCACCAAACAGTCAGGAAAGCCGTCAGTGATAATAGGACAACAAAGGTAAATGAAGCGCGGCTTGCCGTAGTGGTA