Description :
From Genome Similarity Track
Location :
Scaffold_751:11643- 12705
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_751-fgenesh-gene-0.3Gene of unknown function

Sequence
1062 bases(100 bases per row)
TCACGCGCGCGCTGCGGGAGCTTGTCGACCCGGAAGCCGTAGTTTTCCTGTGCCACGTCGGCGGCGATGCGCTGGAGCCGCTCAATGCTTCGCACCATCT
TGACGCGCTGGATCTCGAGGCCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCGGTCTGGCTGCAGTAGGGCGTCCGCGCCGGCGACATGGGCTCGTCGTCGC
TTGTCACGACGACCTCTTGGAACGGATCGACGTCGTCGACCATGAACGCTGCCATGGCATCGAGCTCGTCCACGGGCGAGCCGAGGATGGGCTCGAGCAG
CACGCTCGTGGCGTCTTCGTCGTCCTGTGCGGTGTGCTGCACGGCGATGGTGAGCGGCGCCGTCTTGGTGGGCGTGGCCGGCGCCGGCGCTGGCTCGGAC
GTGACGCGGATCTCGCGCACGGCAAAGGACGTTTTGTCGCCAAAGAGCCACGCGTCTTCGTCGGCCGCGGCAGCCAGGCCCGCCACGGTCGANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGCTTGAGCGGCATGGCGAGATCGGCGAAGAAGGCGTCGTGCTCGGGCATGTCGCTCGCCCAGAACG
CGTCGAGCGTAGCAAGCTCGAGTGGACTGTTTCTGGTCATATTCTCATACTCGCTCATGCTCAGAGAAGGTGGGGTGCTGTGTGGGGGCAAATGGCAAAA
TGCAGAGTGAGAGGAGAGAGGAGCCCCATTGAGGAGACGCGCTCAACACACACATGCAGTGGCGAGTCGCTCCAAAATGGAGAGAGCGAGAGGGGGCGAA
GGAGGATGCAGAAAAGGAAAGCAGGCGGACAAGAGACAGGCGCAGAGCCTGGGAGTGCTTTAGCTGCCCTGTCCGCGAAGGGGATGAACACTGGCTGGCC
TGTCTCTGGCGCACTTTGGAGAAAGGACTGTCTCTGGTGCAAATGGCCCGGCGCTAACACCA