Description :
From Genome Similarity Track
Location :
Scaffold_778:11641- 15165
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_778-snap-gene-0.9Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_778-fgenesh-gene-0.4GAF sensor protein

Sequence
3524 bases(100 bases per row)
CGTGCACTGGTCGTGCTTGTCGATGAAGTCGTCCGCAGTGTATCCAAAGACCGCGAACACGTCGACGAGGTTCTTGATCTCCAGCAGGTGCTTCTTCGAG
TTCGTCGGCGCCTTGGGGTCTAAAACAGTCAGCTGCTCCAGCTTCATGATTGCAAACTGCAGGTCGTCTCGCAGCTGGTGGGAGGATAGACAACAACGCC
ACAGAAACGATAGGAGCCTTAGGAATCTCGAACGCGTCGTTAAAGCACCAGCCATTCCACATACCCACACACCTTCTGCTTCTGGTCATCGTCCATGGCT
TGCCCGTGTGCCAAAATTCAGATTGCCAACTGAGCGAGCATCGCCGTTCAAAAGCCCCAACAAAAGCCTGACGGAAGCCAAACTTAGACCGCCGATCAGA
TAAGAATCTGTTCAATACCAGATATATCACCACGATAGAGAGCATCGATCCTACCCCACTACGTGAAAAAGCGAACGGCGACATGAATTGGAGTAGACGA
GCGCGTTGTAGCAAATGGAAATCTCAAACGAACTCCTGTTACAGCCATGACGGCAGGAGCGGAACAATGAGCATTGGTCTGAGGAGGTCAGAGGGAGGTG
CTGCACGGCAAACATCTTAGAATGCCAATCAGACAAATATCTGCCAACAAAGCAAGGAGATTGCAAGCTCGTGACAAAACAAAACCATGACATATATGGA
AAACTTGGGAGAGGCGCATGCATACACATAACTCACTTGACTTGGTGGCGTCGACAGCAAACAAAGGAATCTTCACGCAACAGATAATGACACTTGTTGA
ACCAAAAATGAATGGAGCTTGGGACTAGCGAATCTTCGCTGTCAATATGATACTTCCATCGGCACGTTTGACACTGATGAAAGCATTCAGTAGTGGCTTC
TTGGCGTGAACGGCACTGGCGCGTCATCTTCTTCATTGAAAATGTCGGCCGCGAGCTTCGTCAGCGCGATCATCGCAGCGTGATCGTCGTGCGAGATGTC
GTCGTGCGAGAGTGTGTCGACTGTACACAGAGACGCCACGACGACGCCGTTGCGGTCCTTGATCGGGAAGCCCGCAAAGAATTGGATGCTGGCTTCGTGG
ATAATCGACATCCGGCGGAATCGGACGTCGTGCACTGGGTTCTTCACGACCAACGGTCTGCCGTCGGCGAGCAGTCCGTTGGAGCGGGTACTTTGATTAC
GTGGCAGTCGGTAGGCGCACGTTTCCACTTGGTACGTGCCAACAATGTGCTGTTCGTCATTGCCCAAGACCGACACGAAAGCCATCGGGCACTTCATGCG
CTGCGCCGCGATCTCGCAGATCGCATCGAGACCATCGCCATTGAAGTTTGGCAGAACTTCAGGTTCTGTTTCAATTGACACATTGAAGAAGCGACGCTCT
TTCTCGAACACGGAATGCCCGCTCCCGAACGATGGCTGGTAGAAAACTGGAAACGATCGCCCGCTGTCATTGTCCTCAACCGAGTAATCATTTGACGAGA
TCGAAGTCAACCGCTGCCTCGCTTCCAAATACTTCCCGATGAGGACCGGGTCGAGAGGTTTGTTATAATCGTGTTTCTCTTGAGTGACCTGCTTGACTGC
CTTCTTTAGCACTTCGAGAGCTCTGGCACGATCAAGAGGGTGGGGAGAGAAGAGCGCCTCGGCGAGTTGGTGGCCGGGCTTGGGCGACTCGAGCGCATCG
GCAGGCAACAGCAGCGTTCGATCAAAGTTGTGGCGTCTGAGTTGGTAGTGGTCGTCATCATCGTTGTCTTCTTCGATGGTCTCGTACCACGTTGACGCCG
TGGATTTGTTCTCGCCAAGCGAGCCTTGAGGCTTGAAGACGCAGTTCTCGACGCGGCTCGCACAGGAGTAGCAGACTCGGTTCTTGCGGACGCCTCCCGA
GAGTGGCTCAACCTCGTACTTGCGCGAGCAGCTTCGACAGACGTGGTGGCCACACAACTGGCAGAACTGGTTGCGTCGGAGGAGCCCGAATTCCTTGTCA
CAGACAGCGCAGCTGGTCTCGACGAACGTATCTCGTTCTGCCATCACGTAAATGAATGGGTGCTGGCCAAAGCGTCGGCGTCGGATTACCTTTTCAAAGC
CACACGCGGCTTTGGCGAGCTGCATCACGATGTGCTTGGCGTCTGGGTTAGCTCGGTCGCTCGCATCGTGAAGCCCGACGCGCCACTGCATGACCTCTGG
TCGCTCATTTCCCGAAAAAGTTGAAACGTAGGCGCACATCACCAGTCGAGTTTGGTTGCCCGTGATGTCATTATAGTGTCCAGTCAGATGGTACCCCACC
GCGATGTGGTCGATACCTCCACGCAGAGCCGAGCGCTCCGAGGTCTCAACAAGCTGATCGTGTACGTCCAGCGGCAGGGTCTTCATCATGAACACGGCCT
CGTTCTTGGTCGTGGACTTCTGCGAGTACGCACTGAAGCAAAGGCGTTGCGTGCGGTCATGCTTGCCAGTGAGACTGATGTCGATCTTTGGGGCCACGAC
AGTGGAGTTCACTGAGATCCATCCGGACTCCATGAGATCGTCTGCTTTCTCTTCCGCGTGCCAGTTGATGCAGTCTGACGGCAACGTTGTTCGCAAGTCT
TTCTTGAATGGCTCGGATCGGAGCTGGTCGCCGCTCTTGAACTTCTTTCCCCACAGCGCTCGCATGCTGGACTCGTAATGGATCGTCTCCTGACTGAAGA
GCACCTCGAGCGCTTCATTGATATCGCAGTTGAGGTCGCATTGCGCCACTGCAGCGTACGGAACACCGGTATTTGCGTTCGGCCAGGAAGTGCCATAACT
TGGCTGGAGGTTGAGCGACGCGGCGGATCCGCCGCGCGTCCGCCCCGTGTATGGAGGCCGCGTCCAAGGCCAGTGTCTCGAGGTCGTCGCGAACGACATG
GCGCGCGGGCGTTCACTGAGAACGCTCGAGAAGGTGTCGTACTCGTGGATATCCACGTTGTGTCGTGTCGTCTTGGATTTCCAGTTGGGGCCCTCGAACT
CCTGGGTCGTCGACGCGGCGCGCAGGTTCGGGAGCACTTGGATCACGTTTTCGTAGATCTCGTTGTCTGAGAGCATCTGTGTGAGCGCGTAGCGCTGATG
TGAAGGCAGGTTAGCCCGGTGGCTTGGTCCATGTGACCGCATCATCTCAAATGTGTGTGTTTGTGTGGATAGCGTAGCGTTGCCTTGAGTCAGCTGGTGC
GTGTGTGTGGTACGCTGCAAATCAAAGAGTGATCAACCAGTCCAACCGGCAAGAGCCCCATGACCAAAGAGGCACTTTGAGGGGGCCGTAGCAGATCTTC
CTCTTCAACAGCAGCAGCAGCTCAGCAGTAGAGCATGCGCTTCGTCAAGGAAGCCAACAAGATCCATGACGCCACTGCGACGATGCCACTGCGATCTTCT
TGCTGATGGAGTAAACACGGCATGCAACGCGCATAGCACAGTACTGCGCCGCTGATGTGTATGTATCACGTACGTCAGGCTCTTCTGCGGTTTTGATTCC
TTCTTCTTTCCATTTCTTCATCAT