Description :
From Genome Similarity Track
Location :
Scaffold_70:116409- 119199
Sequence
2790 bases(100 bases per row)
GCTAGAGGGGACGACGGCCCACCGTCAGGCCCAAGCGCCTTTCGGTCCACGAGAAAAGAATCATAATATGGCTTAAGCAAGCCAACGCAAAACACTAGGT
GTGTGCGTAACTTGCGCAGGAGATTGAGAGTATAGGCAATGCCCTTCTTCGCTATAACCGTAAACGGCCCAATGAAGCGCGGACGCAATTTCGTCTTGAA
GACGGCAGACACTACATTTGTAGGTAGGTTTTTAACATTTAGTAAGACTTGGTCTCAAACTTCATAAGAATCAATACATCCTCTGCCTTTAGCATCAGCT
TGTTCACTTTGTTTGTCTTGGCTAACAGCCATTGCATTTAACAGGTTTTTATTCAAAAGATCTATCACGCACATTGTCGTAAGACACTAAAGCGCGTCGC
GAGTAACTCGCTCACTTGTTTCTGCATAGTGGTAGGGATGATTTAAGAAATCTTGTCAGACGACTATCCCCCACCAAGCCCAGAACCACGGAGTGGTAAC
GTGAGCGGAACGCGGGGAGGAGTGAGGCTATTCACATAGAAAGAAGTAAAGCCGGTTGAGGCATGAACAGCATTGTTCAACGCAAACTCAATGACAGGGA
GAATCGAGCTCCAAGTCTTAGGCGACTCAGCACAAACACTGCGAAGAACGTCGCCAATGAAGTAATTAACTCGCCAGTCTGACCATCGGTCTGCGGATGG
TCCGCTGTGGACATGTCCAATCGCGTGCCAAGCACCTTGAAGATGGAAGTCCAAAACTTACCTGTGAAGCGAGGGTCGCGATCAGAGATGATTTCCAGTG
GCATCCCGTGTTGACGAAACACACGATCTATAAACAGCATAGCTGTACCTTTGCCATCGATGGAATCTGGCAACGCCGCCAAGTGATCCACCTTGCTTAA
AAGGTCAGCAAAGACCACAATTCCCGTATTGCCGTCACAGTCTTTGGGAAGACCAAACACAAAATCCATACTGATGGACTCCCAACACCCCGTGGGCACA
GGTAAACTGGCGAGTGCAAAAGCCGAATGTGCTGAGGGTTTGACCCGCTTGGACGTTTTGCATGTACGCACGTATGTGCTCACCCATTTGTAGAGTTTGG
GCCACCAGTAGTGTCGACTCACAGAGTCATAAGTCTTTTCCTGGCCAAATGACTACTGAGGGCAGTATCGTGGGCCTCAACGAGGATTCAATACTTTAAA
TCCTCATCGTGAGGTACAAGAATGCGAGCGGTATCCGCTACATCTGTGCGATAGCACAAGAGACCATTATCGATGAAATATCGATGTAGGCTGGCCCGCA
AGCGTGCCAATAATTGACTGTCCGATTCCTTGTAATCCTCACTCCCAAGGGCATGAAACAATGCCACACACTAAGAATCCCGTGGATATGCTACACGAAT
GAGCTCCTCAACAGGAGACGACAAAATCGTGACATGAGCAAGCTCATAATCAGGTGAGAGTGGGCATCTGCTAACACATTTGCCTGGATTATACGTCACC
TCGAAGTTGTATTCCGCAAAGAAGGAAAGCCACCGAGCTATTCTCTGAGAGAGGTGAGGTGACTGTGTCGCCGTGCGTAATGACGCATGATCCGCATAGA
CGACGAATGGCTTGGATCCAAGCAGATGGACTCTAGATGTGACGAGCACATACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTTTCAGC
AGCTTTCAGCTGACGTGATTCAAATGCGATAAATGCTCGTGGCCTGCAGCATCTGTTTGTAACAGGGCGCTGCCTATGGCAAAGTCGGATGTATCGCAGA
CAACACTAAAAGCGTACTTAGGATTCGGCAACGCCAAAATGGGAGCATGTAGGAGACTCTCCTTTATTGCCCGAAATGCATCGGCATGGGTGTTGTCCCA
GTGCCAATCTGTGTTCTTCTTAAGGAGATCAGCTAATGGCCGAGCCATATCAGCGTAATTTTTACTGTATTTGTGTTAGTAATTGGCAAGGCCGAGCCAC
TTACGCAAGTCCTTTTGATTTTTAGGAATCAGCCAGTCCACTATAGCCTTGACCTTAGCGGGATCCACTCTAAGGCCGCACTTACCTATGAAACATCCTA
GATACGGAATCTTCTCTGCACCAAAAAAAATGCATTCAGACTCGTTGGCGTATAATTTATTAGTGCGCATGTACTCGAGCACGGCTCGCAAATGACCGAT
GTGGTTGTCAACATCTGACTGACCTTGTTCGGAACGACTATGGACAAAAATGTCATCAAAGTATGTCTGTGCGTAACCCCTTTGTGGGCGGAAAAGTTGC
GTCACCAGACGATAAAACGTATTCGGAACATTAGACAGCCCTTGGGGCATCACCAGCCATTCCCAAAGCATACCACTCGGGGTGCTCACTGCCGTAAGCG
AAAATATCACTCGCTCGTATGAGAGATTGATAAAATCAATTGACCAAGTCGAGTGCACTATACATAGTACAATGAGCCGTGCTGTTTTGAAAAACATCCT
TCCGAGTAATGGGCGTCTGTGCTGGAATGGTAACCGCATTAAGCTTGTTATAAGCATGCACAATACGCCACTTGCCGTTCGGCTTTTTGACACAAAATGT
CGGTGTCGAATGTAGAGATTTACTCTCACGTACCCTTCCTGCCTCGTGCTTGGCACGGAAGAAGTCATCAATGACATCACATTGCTGCTTAGGCAAGGGC
CACTTTCGTGTGACGCAGTATTAGTGCCAGGAACTAAGTCAATTTCATGACGGACACCTCTATCTGGAGATAGAACCGAGGGTGGATCGT