Description :
From Genome Similarity Track
Location :
Scaffold_135:116407- 118044
Transcript NameFunction/comments
Hyaar_Emoy2810726predicted protein

Sequence
1637 bases(100 bases per row)
CACTCTAATAACCCCTTTCTTCCCCTAATCCAGCCTCTAATCAAGTTAGAGGAACCTCGCGTACTTTATACCTCGTGTCAACCACACTATCTTTTCTCAC
AGCCAAACAAGAACAGTCAAAGATCGAGACACCTCGAGAAACTAAAAAACCTCACGCAGTAAACACTCGTAAAAACAAACGCTCGCCAACGACGTCATGA
GCGGCGACCAGGACGCAGACGCGGCGGCAAAAGCGGCTCTAGCGACGTCTACAGCCGCTGACACGCCGTCAAAGACCGAGCAGAAGGAGGGAGAGATCTC
GGCCGAGGCGACTGTGGCGCCGTCGGAAGCAATTGAGGCCAAGAAGAAGCCAGTACTGAAGGGCAAAGCCAGCAGTGAACAGGTGGTCCCCGTCGAGTCG
AAAGCGCGCGCTGTAGGGAGCCCCCGCGTGTCGGTCAAGAAAGTTGGACCGTCCAAACCGGTCGAGGAAGAGGACACCGAGTCGGAGCCGGAGAAGCAGC
CGAAGAAGCGCGTGAAAACGAGTAAAAAGGAACCTAAGACTGGTGGTCGTAGGAAGAAGACGCCGCAGTCGGACGACGATGACGACGTTGATGAAGAGCA
AAAGGAGGTGGAGAGGAAGGTCGGTGCGCTGAGTGACGAGATCAAGGGCAGGTTTGGCCAGATTGCCTGGGCCAAAATGGGGGGCTACCCGTATTGGCCG
TGTATTATCACGGACCCAAGACTGCTGTCTGTAAAGCTGCAGGAAACAGCCGTGAAAGTGCTGGAGACCAAGTACCTTGTATTTTTCTACGTCTCGAAGA
ACTTGTGAGTAGTTGTGAAGCTGCTGGGGATTTTTTGTCTGAAGGGATAGAGAATGGGAGGGGTGGTGATGCTCATGTATATTGTCGTTGTCGCTTTTTG
TGTGTGGTGTGTGTAGTGCTCCTGTTTCGTTTAAGTCGATTGAAGCGTGGGATGATACCAAGTGCAAGTACCGTGAAGGGTACCCGGAGAAAGACTCGAA
GGCGCCTAAGCGACGAGAGAAATTGATGGAGGCTATTGCAGCAGCCGATGTACGTTAACTCGATAGGTGCAGAAGAAGAAGATGTGTAGTCTGATTAAGA
CTAACACGTTGTGGCTGCTTTCTGGCGTATGGATGAGCAGATAGAGACAAAGCTACCGATTGAGGATCGAGCAAATGGTCTCATGAGACCCGTAGAGAGG
GAGGAGCTGGTCGTGACGCCTGTACCGGTCAAACGGAAGCCTGGCCGACCACCGAAGAACAAGACAGCGGTCAAGACTGCTCCGAAGAAAACACCGAAAA
AGCGACAGAAAAAAGACGAGTCAGCAGATGTATACGACGGCAAAAAAGCTTCTGTGAGTACGCTCGAAGAAGAAGAGGATACAACAGGTCCGACACTTAG
CAAGGAAGAAATGAAGGCAAAGGTGGCGAGTCGTAAGACGCCGAAGATGAAAGAAGGTGATGGCACTACCAGTGGTTCCAGGGTATATGTAAAGAAGACA
GGTTCTGCGAAGCATGGAAAATCGAATGGCTCTGCCGAAATCGATAGTAAACGAAAAAAGGAGATCGAGCTTGTGGTCCCCCATAAGTCCGTAAAGTCAG
CCGACATTCGTGAGATGACGGACGGAGCTGCCAAGAA