Description :
From Genome Similarity Track
Location :
contig_217:11640- 13103
Transcript NameFunction/comments
g14302.t1hypothetical protein

Sequence
1463 bases(100 bases per row)
TACAAGTCGTAGTTCCAGCGTTCTTGAGCGTACCGAATCTCAGTCTTCTGTGGAGCGTAGTTGGGGAAACCTTGAAGCTGGGCCTTGCTCTTCTTACCGA
AGAAGTACATCTTGATCCCGAAGTACCTGAACGACGACGTGATGTCTGGATCAACAATCTCGATCTTGCGAAGCTGCTCCAGGCTCAGATCTTGAAACGG
GATATCAGCCAGAGGAGTTGAATCTCGACTGCTGAAAAGGTAATTGGTCTTGGAGTTCAAACGCGCTTTCTTGCGCGCAGATCCCGAGTGAGAATTGGAG
TCCTTGGAGCGCTTATTCTGTGAAGAATGCTGAGGAGTCGAGCGAGGCGCTGAATCTTCTGAATCAGAGCTGGACAAGACGGTTAGAGACTTGGGCTTCT
CCTCGAGAACGTCGGCCTTGAGGTACTCCACTTCAGCTTCGCCTTCAGCATCGTCGACCTCTTCTTCCTTGTCAACAGTCTCAGGGTCAAACGGAGAGTC
GCCGTCGCTGCTACTCTGGTCCGAATTTTCAGGAATTAACTGGTCACACACCACTTCGACGAGAGGATGCCAAGGCTCAGGCTGAAGGTTTCGTGCAAAC
ATGTGCTCCAATCGAGTTTCGGCGCGAAGGAAGTACATCTCAGGGACGTACTGCGTCCAAGGAGTTGAGTCCAGTTTTTCGAAATAAATCATGCTCACAA
GCATGGTTACGAGAGGCTCCTGATGGAAGACGGGGTGAACTACCTTGTCCCCGCTCACAAACTCAACTGAGGTCTCGTAAGAACACCCGGTGAGCATAGT
GTAGCGAACATCCAATCTGAGGTCGTTCCAAACTACACCTCCCGGGAGATTCCCGCGTGCAACTTCCTCCGTCCACTCCAATTCCTCAGTTCCAGAACGA
GCATACTCCAAACACGGCAAGCGAGAACTGGGACGTAACGGGAATGAGCCCTTGAAACTGATCCAAGACTCTTTCGCTGCAGACTTGCGAGTCTTCTTCG
GTCGTCGAGATTCAGGAGTCTGAATTGGATTCTTAGAACCCTTGGACTTGGGACCAGAGTGAGACAAATCTAAGGTCTTGGGCGGAGTTTTCTGCGGAGA
GTCTTCATCATCGTCATCTCCAGCTTTCTTGCGCTCAACCATGTAGTCCCCAGGGACGCACCTTGGATCGTCGACAGCGAGGACGTTGATGTTTGAGATC
CACGATGAAGGAGGCTTGGTCCGTTTGACGAAGTGCTCGAAGAGGCCTTGAAGTCGTTGCCAATTGGATGTGATTGAGACGTTTGGATCTTGGTTCAAGA
AATCGGTGAAAGACCACGAGCTCAACTTCTTCTCCATCATGTCTCGACGCAGAATTTCACACCGAGCCTCAGATGTGTTCAGTTGATCTTGGAGCTCAGT
GATCTTGTCATCACGCTTGTTTAGCTCCAGCTGGTGCTCTTCGGACATGGATCGGATCGAGGC