Description :
From Genome Similarity Track
Location :
Scaffold_1605:1164- 2590
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1605-snap-gene-0.1Glucose transporter

Sequence
1426 bases(100 bases per row)
GGGCGACGACAGCTTGTCCAAGCCGACGTGGGTGCTCTACACCAGTGTACTGCTCTCGCTTCTGCAGGCGTTCCAATACGGTTGGGCCACTGGCCAAGTC
AACCTCAAGACGTACAACAACACGGAGCAATGCAAGGAGCGTCCGGTTGAGCACGGCACCTGTGTCATGTTCCCTGGCCACACCCACACCCAGTGGACGT
TCCTCGTGAACGCCTGGGTCGTCGGCGGTATGTTCGGAAGTCTGCTCAGCTCCAAGCCATCGGACACGTTGGGTCGTCGCCGCACGCTCTGGTTCAACTG
TATCATCATGATCGTGGCTGGTGTCGTTGAGATGACTGCGGACAACATCTGGCAATTCGTCGTCGGCCGTTTCATCGCTGGTATCGCGTCGGGCTTCGCG
ACGGGCATCACGGGCGGGTACATCTCTGAGATCTCGCCTCCACACCTTCGAAGTACCTTCGGCACGGGTTTTCATTTGTCGCTCACAACTGGTGTGCTCG
TGGTCGCATGCACGTTCTTCTTCCTCGACACGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGCGCCTTCATGATTTTT
GCGCCAATGTTTATGGTTGAGAGTCCAGCGTGGTTGCTCGCCAAGGGACGACAAGCCGAGGCGGAAAGTGAAATCACGCGCCTGTACGGCAAGGAGCAAG
TCACCAAGGTGCTCGGTTGGATGCAGCCTGCTCGTCCAAACACGTCCACAGTGTTCTTCAGCAACAAGGACCTGGAAGGTGGAAAGAAAGAGTCCGTTGC
AGAAAGCAAGGGCTTCTGGGCGATCTTGGAACCACAGTTCCGTCGTCAGCTCATCATCGCTGTCGCTGTGTCTGGCTACCACCAAGTGACTGGTATCAAC
GCTGTAATTTTCTACTCGTCGTCGATCTTCTCCAAGGCTGGAATCAAGGACCCACGCGTCGGTACGCTGATCGTCGACATCGTGAACATGGCGCCAACGT
TCTTCTTTGGTCTTGTTGCGAAGCACTTCAAGACCCGCACGATGCTGCTCAGTGGCGCCTTACTCATGCTTATCTGCTCCATCGTCATGACGTTCACACT
CGTGTACGGCGTCAACGGCGTCTCAATCGCGTTCACAGCCATCTACGTCGGTGCGTTCGGTGTCAGTTTTGGCCCTCTCGTGTGGTCGGTGACCGCGGAG
CTGTTCCCTGTCGAAGTCCGCTCGAGCGCGGTGTCGCTCTGCATGACTGTCATGTGGATCGCCAAGCTGATCGTCGGTGTCGGCTACCCCTACCTCAACG
ACTGGGTCGGCAACTACTCGTTCATCCCGTTCTCCGTCATGCTCGCGTCCTCACTGTTGTTCATGTGGTACATGGTTCCGGAGACCACGAACAAGACGAT
CGACGAGATCCAGCAGGAGTTCAAGG