Description :
From Genome Similarity Track
Location :
Scaffold_2577:1164- 2583
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2577-snap-gene-0.1Amino Acid/Auxin Permease (AAAP) Family

Sequence
1419 bases(100 bases per row)
CCGACCTTGCCCATGCAGAAGTCGCCGAGATCGCTGTAGGTTTTTACCGAGCTTGGTGCGAGGAGCATCACCTTGGAGATCACGACGGACGCGTAGATGT
TGGCGGCAGCCATGAAGAGCATGGCAAACACGGCGATCAATGGGCCAGCGCGCGAAAAGTTGCCCGGCATACCGAGTGTGCCCACCCCGTAGACACAGCA
GAAAAGGTTGGCAGCGACCTTGGCGTCTTCTAGCGTAAAAAGCGGTTTCTTCACCATGTCTTGTGATGCTGAAGACTGGAGTTGCTTGCGCTGGAGCTTT
GCTCAGGAGAAGGCAAATTGTAAAATGAGTTCAAATCTGTTGTGCTTTGGCGCTTCTCGGAGAAAAGACCGGTGGAGGCAAGTCCTGTTTGGCTAGTTCA
ATCTGGTTTCAAGACAGTGAACACAGGGACGTAGACCAGCCTATGGCGTTGATTTACTGCAGCAGCGCAGATGGGGCGGCTATCCAAGTGCTCATGATGC
AACAACGGAACCCAAGAATTTGCAGAGAGTTGGCTCCAGTTCACTCGTGAAGTTGTGGGATCTCATAACAAGAGGTGGGTTTGGGGTGGGCAGCGAAGAG
GCTGTGTGTACAAGGACAACGAGTTGGCGAACAGATCCATGAAGAAAAAACGTCACCAGGCACATTTCGGAGCGGAGGCAGAAAGTGCAACCAATCTCAT
CAGACCTTTCGGGTTTCTGTAAGTTCAATAGAGCACGCGAGGTAAGGTGCTTTTTTTTAAAAAAAATGTGAGCTCATTTGCAATAATCGACCACAGCAAG
ATTGATCCGGATCTTTTAGGATCCTACTTTGAGCTGCAGGTTGTCCGCTGTGTGCCATGCGCAAAGATTCTTTAAGGGACAAATCAGGAAAATGGTAAGC
AACTTCAAAAGTCGACTGCAGCAAAGGTGTGGGGATTGCTAATAGTGGACTTTCCAATAGACAGGATGACAGAAGCTTTCTTAGCACTGTACGCTCTGTC
GGTATGCTCAACTCCACGACCTTTGTGCTACAATCTCAAGTTTTCCATTTCATTTTCGAGCCAAACATGCATTTCGTTCACCCAACACTCTTGATGTGCA
CTAATAGCTCAGCCAACCTTCAATTCGGTGTACCGGATTATTTGTGGACAGATGTTCCCGCGCCTTTTCTATCCTCCCAGTCCTTCCAAACGCACATTTT
GACGCGGGAGCGTGCGTCAAAATGCGTGATTAGACGAGGTGAGGGGTCTGCGAGACTCAGTTGTTGTAGCCACCTCGACATGGCGCCCTTTAGGGATCGA
TGGATTCCAAATAGAGCAAGAGTAAAGAAGACAGGAAATGCGCAAACAAGTTGGCTCAAGACATCGCCATCAACATGGTGCAAAATTACTCCGGAGCAAA
CTACCGTAGAATAGCCCGG