Description :
From Genome Similarity Track
Location :
Scaffold_2580:1164- 2270
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2580-fgenesh-gene-0.0Solute carrier family, facilitated glucose transporter
Pytar_ATCC12531maker-par_contig_2580-fgenesh-gene-0.1Carbohydrate-binding protein

Sequence
1106 bases(100 bases per row)
AGGCGCTGATCGTCGACTCGTTCCTCTTTGTGCTGGCCGGTGCGATCATGGCGTTTGCCGCCAACATCTACATGCTCATTGCCGGCCGCTTCATCGTGGG
CTATGCAGCCGGCACCGTGAGCGTCGTCGTGCCGCTCTACCTCGGTGAGCTCGCGCCACCCAACTTGCGTGGCGCCCTGGGCACGGGCTACCAGTTTGGC
GTGGTCACGGGCATTCTCGCGGCGTCGCTGCTGGCGTTTGGCTTTTCCGGCCCGAGCAACGGCCTCGCGCAGCCCGGGTGGCGCTTCCTCATGGGCTTTA
CGATCGCCCCGGCTGTGCTCCAAATGGCGCTGTCGTCGTGGCTGACGGAGAGTCCGCGATGGCTGCTCACCAAGAACAAGCCCAAGGAAGCCGCCGACAT
TTTGCGGCGCCTGCGTGGCTCGAACGACGTGTACGAAGAGATTGACTCGATCTGCTCGGCGAGTGACAACGAGTCGGGCGACATGGGCTTCTGGGCCGTG
CTCACGGACAGGTCGATCCGTTTCCCGCTGCTCGTGGGCGTCGTGCTCCAGATCGCGCAGCAGTTTTCCGGTATCAACGCTGTCATGTTTTACGCCAATT
CGTTTTTCAAGAATGTCGGCCTCGCGAACCCGCTCGTCGGCACGACGCTCGTGCAGATTGTCAATGTGCTCTCGACGGGCGTCGCGCTCGTGCTCATGGA
CACGGCGGGACGGCGTCCGCTTCTCGTCTACTCGACCGTCGGCATGATCTTCTCGACGGTCGTGCTCACGCTCGCGCTGCTCAAGCTGCTGCCGTTCGCC
GGCATGGTCTCGGTCGGCGGCGTCATGTGCTTTGTGTGGTTTTTCGAGATTGGCCTCGGGCCCATCCCGTGGCTCATTGTCGCCGAGATGTTCCCGGCGC
GTCCGCGGCCCACGGCCATGTCGATCGCGACCATGGTCAACTGGGTCTGCTCGTTTATCGTCGGGCTCGTCTTCCCGACGCTGCAGTCGTCGCTGAACGA
GTACTCGTTCGTGCCGTTTGGCACGTCGCTCGTGCTCGCGCTCGTGTTCGTGCTCAAGTACGTGCCCGAGACCAAGGGCAAGACGACGGCCGAGATCCAG
GACGAC