Description :
From Genome Similarity Track
Location :
contig_169:11639- 13102
Transcript NameFunction/comments
g14009.t1POM68454.1 LOW QUALITY PROTEIN: hypothetical protein PHPALM_15386 [Phytophthora palmivora var. palmivora

Sequence
1463 bases(100 bases per row)
AATCTCCATTGCCTACCAGCACTCCGACAAAATCTTCAGTAACTCATGCTTCCTTGCCCATCTTGTCCGCAGCAGGTGGAAGTGTCAGTATCTCACTTCG
TGACTCCAACCGGGCCTCCTTGCGCTTCTGCTTCAGCCAATGGTCTGTACCAATCTCGCCCTTTGCTCCGCCGTCGGTATACAGCTTCAGTCGCTTCATC
ATGTCGGCGATCGATGGAGGAAATAACCCGGTGCAGGAAAACCCGCTAATGGCATTGTTGGGTCGCTCAATAATAGAAGTCTGGTAGACCGCACACGTAA
TCTGAATGGAGGCTCCTTTGGACAGTACCATGTCGGCTGTATCGTGTAGCTTTGACTGCAGTGCGTCCGTAACTGCATTTTTGAAAGATTTAAATACGGC
GACGTCTAGCGGCTGGCACATATGGGTAGCATTTGGTGGCAGCGTCAGCAGCAAAATTCCTTTGTCTTTCGCTGCGCCAATTGACTCTTAAATAAAATAC
CCGTCCAAACCGATAAAAAAATTAATTTCAGTTTGAGCGTATTTGGGTAAATACAGCACGTACCGATGTCGAGGTGCGTTGAGCTGTTGTCCAGCACTAA
CACGATAGGGAATTCAACGCCAAGTCTTGTAACTTAATCCGCAAACATGGACAACCACAGACGAAAAATACTTCCGTTGCTGAACTCCTTCGGTGCACCT
GTCGCCCGTGCACCCTTGATGGAAAGTTTAGCTTCTCGGTCTTGTAAATGTGCTTGCCTGGTAGAACAATAAGGAGAGGAATCGCAGACCCCGCAGCGTT
TACCGCAGCCACCACTGCCATGTGGAAGTTGGGGCGCGTCTCCTTACTCCATACGTTGGGAGAGCCCCGCCATACTGCCGTTTGGGCTTCACGTTTCGTA
GTGCCACCAGGAGAATGTGGTGCTAGCCACCAGCCAACAAGAATAACTTTGATAGTTTTTACGCTCCTGCAAAAACGTATAGTATACCATACACTAAAGT
GATATTGGGATATCTAGCCAATCAGGGGGCGCCACTATAAAAACGCGAGCTGTGATTGGACAAGAACTTGCATCGTGCACTAAAATGATCCCAGGCACTG
AATTGGCACTGGCCGTTACTCTTCCTTCTGAGGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTATAGCCCTCGCTCGTGGCCAGTAGTGCAGG
TTTTGAGATTGACCAAACTCAACCTGGGTATACAGAGGTGCTTGCAACCAACCCGGTGTAAGTGATCGTTCCAAGTCTTCAGGTGTTGATCGAACGCTCG
CTGATCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGGTTTTCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCC
GGGATTGGTGTGACCTTCTGTGTGTCTTGGTTGCATATAGGTTCTTGCCCTAACGAGCATTCG