Description :
From Genome Similarity Track
Location :
contig_1:116370- 121776
Transcript NameFunction/comments
g16.t1hypothetical protein, variant
g17.t1hypothetical protein PHYSODRAFT_513613
g18.t1NADH:ubiquinone oxidoreductase, NDUFB9/B22 subunit
g19.t1hypothetical protein

Sequence
5406 bases(100 bases per row)
CCCAGAAACGTAATGGTATGCGGCTGGACCACCACCAAAGTGTCTTGGTCCGCTCTCGGGTGCGCAAGGTGCAGAGCGAATTGCGCCACTCGCGTGTCGT
GCCAAAAGACTGCAACAACCAGCACCAAACATGCTGTGTAGTGCTCCGATGAGGTAGAACCACGTCCAGTAACTCTTTGGCACCTCCACGCGCAGCAATG
ATAGTCCGGGGAGTTGCGCGACGGCCACGGGGGTGCGCATCTTGCCCTGCAGAACGAAGCCCCGACATGCTCCACTGCGAAACGACAGCAGAGCACCAGC
CACTGCGATAACCCACGTGAGCTGCCACAGCTCCAGCATCCCAATGAACATCATGGTCTCCAATACAAAAAGTTGGTTTTGGTCCAATCATGCAATGTGA
ATGACGTACCCTGTTGCAAGTCGAATGTCTAACATTAAGTTTACCACCGTAAAAGGAACCCATGAGCTCGTGCAGATAAGGTCGTGCACTGGTAATGGTG
CCGCTAAAAATGCAAGCAGAGCTCAAAGCGTGACTAGCAATGGATATTTCTGTCGAGGTGAAGAGGGCATTTGAGATCTGAACGAGTTCCGCACAAGCGA
ATAGCTTTGTCCGCAACAGTGAAAGCATGGTATCACGAGGCTCGTCAATCCACCACACGCGGCGCACCAACAACCCGTTCATGACCACGAGCTCTGGGAT
CGTGGGCATTGACCTTAATGAAAAGGTGACCTTCGACGCCCCTCGGCTCCGCACCAGTTCTAGCAACAACCAGATTGGCACTGGCCAGCCACGCTCTGCG
AACGCTTTGACCGAGTTCATGTACCAAACGACGTCGGGGGCTCTTGGTGAAGGCACCCGCGCGCAGGAACGCCTGAGACTGAGCCAGCGGATGGATAAAC
TCACCGTACACAAAGGTGCGTGCTGCAGCGGCTTCACACTCGATCCAACCTGGAACTGCTAGGGATACTAACGTGATACCTGCTACCTGCTCGTTTTGTG
TTGTTGAATAGAGGTGGAAGCGTCTGGCTCGTCACCATCCGACAGGTAGACGTAGCAGCACCAGAAGACTTTGCAGTCCGCCCAGAGGATATCATGCCCA
AGGCCGTCGACATCAAGTTGATCACTGAAGCTCGAGGTGAGCATCCTTTGTACGCCACCAGCAATCGAGAAATTGGCGCCGACAAGGCACAGCTGAAGGT
CGAGATCGAGCGGCTCGGCCGACCAAACACTTTCACCACGTCGTTCAACGGCTTCCGATACCGCGACTTCGGGCTCAACACTGCCGTGACCAAGTCCCGC
ATCTGCGACCAGCTCGACTACTCTTGAGCTGCAATCTCTCCTTCCAAAAACAAACAAACAAAAGCACCCCACACTCCACTCAAAACACCACCTTTTACCC
GTTCTTTCTTGAATTGGTTCTCGTTGAAATTGCAGCAACGATCTCATCTCTGCACCTGCCGTCAATGCAACCGGGACAGTTTAGTCGTAGCCCTTCTTGG
AGAAGTCCACGAAGACCGTCTCCTTGGCGGGCAGCGGCGTCATGTCAATGTTGATGGCCTCGAGCGGCGACACCTCGACGTCATCGGGGATCACTCCGTC
CGGGAAGCAAACGTCCAGCGGAATGGGCGCGTTACGCATGTAGAGCGAGCCGCCAGGCATGTAGTTGAATATATAGCGGTCCGGGTGCGTGTAGTGGTCC
ACCTTGTCTTGTGCCTCGCGCACGAGACGCTTGGCGAGACTGCATACGGATCAACATCCGTCATAAACAACATCAACAATACCCTGTCAGACCACCGGAA
TCGCAGCAAACTAACCATAGCGCCCTGCAAAAATGTCAAAACTTGAAGTTCAACGTACCCGGACTCCGCGTCCAGCGTGCGGTTGGCGTCGAACTCGGCG
CGGATCTTGGTAGCCTCCTCGTTCCAGAGGCGGCGGTCGATGATCCACGAGTCCAGCGTCTTGAGCGACTGCTTGTACAGGCGCTGCACCGTCTGCTTGT
GCGAGAGCTGCGGCTTGGCGCCCACGAAGCGGCCCACCACCTCCCGCAGGGTCTTGTTCATGTTGGCGTTCACCACGGGCTTCACCATCGTCGCTGCCTG
CCCGGGAGAGTCCTGCGTACGGTCGATTCGGTCTCGAAAGGGGAACCGCACGATCAGCGGTACACTGTACCTCTCGAGGCGACTTAACCGGTTACACTGA
ACCGGATCGGCTATGAACAGACACCCGAACCGGTTAAGCTTCAACTTGCTTGTTGCCTTTTTTGCCTGTTGCTATATTTGAGCTATTTGCTATATCGCTT
TATTGCTGGGGAGTCATAGCGAGATGACGCCGACTAGGAGGAAGGAGAAAAAGACCCAGCGCAGAGAGAAGGAAGACGCCGCTCGACAGTTGACAAGTTT
GCTGTCTACAGAGAGCGACAAGTTGAGCGAGCAGCTGCTGATTGCGAGCGAGAAGGGCAGGCAGCGCGCTGTGTTCCTGCTGCTGCATCAAGGAGTGGAC
AAGGACCGATGCAGAGGCCTCGTACGTGGCTGCCAATTGAGAAGAAGGACGAAGGTTGTGAGCTGACTAATTCGTGTTGCATGTTGCAGCTCGGCTGCTC
TCCGGTGCATCATGCCGCGGCACGAGGTCATTTGGACGTGCTGCAGCTGTTGCTCGACTTTGGGTGGGGTGTGGACGTTCGCAACGACGCGCTAGAGACG
CCTCTGCATCTCGCGTGCTTCGACGGCCACGTGCACGTTGCAGAGCTCTTGCTAGACCGGGGAGCGGATGTCAACGCGAGAACGAGCGATCGAGAGACCC
CGTTGTTTTACGCGACTAGGAAGGGCCAATACAGAACGGTTCGACTGCTTGTCAGACGGGAGTGCGATCTTGCAGCGGAAAACTGCTACGGCGACGTGGC
GGAAGAAGAAGCTCGAGATGCAAAAACTCAAGCTGAATTTGCGTCTGGAATCGAAGACTTGCAGCGAACGTCAGCAGTAGAGGGCCAGCGTGGAAACAGC
GGAGAGTATACGCTACCACAAAAACTTCGAGAGCGAGTACTGTCATTTTTAGATCTGAAAAGTCTCGGGTTTGCTTCACAAGTGTCGTATCGATGGCATC
GAGCTTCGGATAATTCCTCGTTGTGGAAGAAACTCGGCGTATCACGGTGGGGATTGCTGCTTAATGCGGCGATGGGAATGGGCACGGTTCCTCAGATGTC
GATGCTACGTACTGCTACGAGCAATCTCTTACGCTTGAATCTCTCGACAACGGTGTCTCGGCGTCCATCGAGCTGTGATCAAGTTTTTCCCGGCCGATTC
ATGCCGTTGAGTGCCAAGGAAAAAGATCGGCCGCGATATCAAGAAGAAAAGCGACCTCAAACAGCTAACCTTGCAGGAATTTAGACAAGATTTTCCATCA
ATGCTGCATCAATCGTGATTTCTCTCAACCTGAAGAACTTCTACGGTCATAATCTGTTAGTCAAAGGCATTTATCTTCCAGATGCTTGCAACAGTGAGGA
TGCTACTCCTGTTGTTGTCGATGTGCGTAAATTGGAAGTGGCGATAAGCATCCAGCAAAAAAGACAACGACCGCGATGGGGTTACCTTCGCTGCACCCCT
AGCATTCATGTAGTTGCCCTTGCTCAGCTTTGTCGGGGGTATACAGTGTGAGCTTTCATCCTCGCTCTGATCATTGCAAGGGTTTTTGCGTCTGCCAACC
TGGGCATCGCTATTTCACCAGGCTGCGGGCTGGGCTGATCGTTGCCGGATGCTGTTTTTTCGTACCATCAGCCACGAAAGCGTGTTTCGTACGGAGTTGG
ACAAGTTCTTCTGCAACCAACGCATCAACGAGGTCAGCACTCAAGAAGGTAACCTCGACAAGCTTCAGGAAATATTTGGTACGACTTCACCAAACGCGCC
GCCGAGGTTCGACCCGATAGAACGTGTGGGAATATATGCCCCTTTATTAAAGAGGTGACCTCGATCTCATTTTCCGAACACGTTCTTGGACTCCTGCAAT
ACCACGGATAAAGTAGACAAGTGGTGCGGACACCGGACTATGGGACTTCCTACAAACACATCTTCGCTGCTGACTCCATTCTCAGTGAACCCGGGAAAGT
ATCGCTCATTTCAGAGACAAGAGCGTGAAAGTGAATTCGATTGGTTGGATTGGTCGTAGCATGGCTACTACCTCCAGCAAAATCGCCGCAGTAGCATGCG
TGAAGCTGTACAAGTCGAGCCATTTAGACAGTGGGCCAGCCGCTTGAGAAGTCGAGTTGGTTCCAGCCGAAGCGCTTGTCACCGTCCGCGTAGCCGATGC
GAGTGTCCACTGCAAGATCATAGTGTTAAACATTCAAAACCGTTAGCCAACAAAAGATAATCATAATCAAAAGCACTGAAGAAGTTTGCTTACCGTAGTG
GTAGTACAACACGGGGCCGTGCTTCGGGTCATTGAACACTCCTTGGCCTCCTGGGCCGTAAACCCAGTCGTGCGACTCAAGAACGATCGATCCGCCGTTG
TTTCGGCAGTCAACTCCATTCTTGTCGACGAAACCCGATGTAGGGCTCTTGGAGCGGCACACAAGAATTCGGTACTCCTTGCCCTTGGCTGGGCGAGTCT
GATCGTACTTGCAGCACGAACCCTTGGAGAAAAAGAGGTAGTAGTAGCCGCTGTGGGCGAACTCGAAAGCTGCCTCAACAACTTCAAAGTTCGAGGTGAA
GGCGATTTGGTTTGCGGTTTCGCCAGAGCTCTTTGCCGGTAGCGACGCCATCTTCGTCTGGTGAAGACCCTGCCAATAGCTGCCAAAGTTGAGATAGTAC
TGGCTTCCTACTTTAATGAGGTTGGGGTCGATGGCATTGTACGGCTTGGACGAATCACTCGTAACACCCACGCTACCGGCATCCACCCACGACCCCGCCT
CCATTGTCTTGGATTGGGTGAGACCGATAGCAGAGCTCTGGGTGCCAAACGAACTAACTGAGTAGTACAGGTAGTACGTGTCTCCGATTTTGTTCACTTC
GGGGGCCTAGCGGAACAACTTTGTCAGTACTGCATAAATATTATTGAAAACAAGTCTCATGAACTTACCCATAGGTCGTCGTTGCCCTTGAGATTGATCT
TCGAGCCATCCGGAACAGCGGCACCCAGATACTTCCACGGGCCCGTGAGTGCTGGGGCAGAGTGAATAGCAATTTTGTTGCCGGTGGAGAAACGGAAGTA
CGTGCCGTCATCGCGGCGGATAATGGATGGATCGTGGGCGTTGGTGCAAACGCCTGTGCACGTTTGGGGGTTGGCGTATCCGTTGACGAGCCCAGCTACA
AGAAGCGGGAGTCCGACGAGCATCAAGAGAAGCTTCATGATTGCTCAGGTGGTGCTTACGGTCAAATGCGAAAATGCAAGGCACAATGGACTCGCTGCAG
AATTAT