Description :
From Genome Similarity Track
Location :
Scaffold_43:116355- 118159
Transcript NameFunction/comments
Aphas_H257_12344Hypothetical protein
Aphas_H257_12345PREDICTED: polyubiquitin-C isoform X2

Sequence
1804 bases(100 bases per row)
GCCTTTATGACCACTTGTTTGCCTTGATAAGAGCCCAAGTACTGTCTGTACGCACCTCCCACCACGATCGATCCGTGCTTCCGATCCATCAGGCCCGCGA
CGATCTCGTCCGTATGGCGCCCCACGACAAGGTGAAACAAGGTGTAGGTGAAACGAAACGACGAAATTGGGGCGACCCGACCCGTCGAGGGACAAAGGCC
GTAAAGTGAGGAGTTTGTTGTCGTCATGTGCCTCGGCGAGCCCCCTACTCAAGGTCATCGTCGGCCATGGTGGTCATTATCGCGGGGAGACTTAACAGAC
GGTGCACCACCCAGGGGGGCAGCTGGCCCAGAGCGCTTCAACACCGTGTCACACAGCGATTGGAAAACCTCCTCGTCGCTGGACGCAGGGATGGACTCGT
GTCTGCTTGTTGACGTTGGAACTGGGTGCCACCTGCTTCAACTGGGGGGGCAGACGTGGACATGTGGCCGGGAAACGGCGTATGCGGCAGCGGGGTCAAA
ATGCTGAGAGGCTTCAGCCTTTGGAGAGGTTGCTGTTGTCGCCGTGCTTTCTGTTGTTGTCGACGTCGTTGAAAGGCCCGTTGAATTCGAGTGGCACAAA
CATCAACGCCCACGACGACGAGGCGGTCCCTTTTGGGGGACATTGGAGGGGGAGGGCTGGTGCACGCACTGGGGCTACTGTTATCCACTGGCGAATATAG
TTGCTGGGCCACTGTAAACTCCATCGTTGAACGTGGTTGGCCAATATGTCTACGGCATTGGCGTATGTCTGACGATGTAATTTGTCATGATCACTTGGGT
TTCTAGATGGTAGGCAGCACTACCGACAAGCGAAACGAAGAATGGTACAGCAGCCAGGGTGGCAACGGTAGTGATGATGAGTGACCGCTATACATGGCTT
CGGAAGACGATGGCTTTGTCCATAATGGTAGCATGATGGCGCAATATGTGGATGGAATGATGGCGCAATATGTGGATGGATAATACCGCGGCAGAACGAC
CTTCGATCGCAATTCGTCACCTGGTTTCTTGTTTCGTCAGGCTATGAATAGGAGCAATACGTTTCCTGTCGTTGCCGATATTCTTTGCAGCATACCGATA
ATGATCGATTCCACTCTCAGATCGAGTAAAATGCAACTCCTTCACATTAGACGAATACCAAACTTTCACCATACAAATCATTGAAATCGAACCCCATCGG
CGCCAGCGGGCGACCAGCACGTGGGACACGTCACCGCCACTTTGCGGCGGTCACAGCTCGTCATCAATGCCTTGAAGCACGCATAGTCTACCTTGTGGCT
GCATGGAAGTACGACCAGGGGCTGCTTGAGGCCAACAAGAGATCCAAAGCACATCCCGCACCCCTTGGTATCCAGGGGGGTTGCGACGACCACCAGGCTT
TGCCACGTCACATTCTTGCCTTCATTAAAGCGATGGTAGAATTCACCACTCGCCGCTTTCCAAGGACTGCTCATGTGCATCCCGTTGTCGATTTGAACCC
CTTCAAAGCGCCAGCGGCAATTGTAAAACCCGCACGTGAAGGGGACGATTGAAGCACAACATAGGGCACAATGAATACGGTGCTGCAACAAGTTAAACGG
CCGCCACTTCGTGGGGCAAATCACTAAGTGCCCAAAAGCGTCGCAGTCTTTGTTTTTGCACACCCCTTCGACGTTCAGCCCGATTTGCACGTGTCGCCAC
ATTGGAGCATCACGCAAAAACTTGCGCACTTCCAAGATGTCATCGTTCGACACGTCGACAAACTCGCCCGCTTTAGAAACATAACTTAAACCCCCGTTCA
GACT