Description :
From Genome Similarity Track
Location :
contig_29:116330- 118645
Transcript NameFunction/comments
g5722.t1conserved hypothetical protein
g5723.t1conserved hypothetical protein

Sequence
2315 bases(100 bases per row)
TTGGACCCGCGGATGTGCTGGAGCGTACCGCGCAAGGAAGGGGGCCGCGCGGCAGATGGAGGCGCGCAAACTCAAGTGTCTTGACCTGGTTGAGTCACCT
GCCACGCTCGCCATCAAGCGGCAGTTGGGCTTGCTCGCCAGTTGCACCGCGGAATTGGACGGCTTTACTTGCAGAGTCTCCGCTACATACACCCGAGATA
TCAGAATGAGCGAACACTGCGAAGTGTCTTTCGTCCTCGTGTCCGTCGACACGCGTCGACAATTGAGCCACATGAGCCGAGCCATTGGTGGAGAGGGAGC
AGCTGATCACCGCCGCCCGCGGTCTGCCACAAATCCTGTCGTGTCAGCTTTGAAGGTGCCTGAAGCGAGCTCCGATCATAGGAAAGATCCCTCATCCACC
TCACTGCTGCAGAGAGCAGGACCTTCGAGCTGGGACCAAGAACAAGAACTGCAGTCAGGCAGGGTGAACAGACAGCGCAGCAGTGATTAGAGTTTGCAGC
GCTGGACGAACCAAGCAACTTCAACATCCGTTATCGAGCACCGGCACCAGTAACGGTAAACTTAAGTTTTTTAGTGCATGCGCGTTCTGCTTGAGTCCTC
CTCAATGTATTGCAGCGGGCGTCCTCGTCGCCGGCAGCCAACGCGGTAGCGCGCTATCGGAGCTGCACCATTAGCTTCATCATATTGTAGGCAGGAGTTC
ACAACTTCAGCCACAACTTCAGTCTTCAGACTGTAGCCATCTGCTCGGATGAGTTCACGCCAAACAATCATTTTTTGTATGAACTGGAACTGGAATTCAG
AAGGCCTTGTCGCTCGCTACCTGGTGGCTGTCCCAGCAGCATGTCTTCTGCGAGAAGCAGACTCACACATCAGTAGCAGGCGATTGACATCCCGGGGGTA
AGGAAAAAAACCCATCAGATTTTAGACGTTCTAAATGATGTCCTTATTTATCAGTCCGCACACTAATAAGGTCCATGGAATCACACACTTCGTGTAGCTT
ATTATCTTAGTCGCGATATACTGCTCGCCGGTTATCAGTCGGGTGTATGCCATTGCAACCTCCAGAGCTGCGATGAGGTCCTGTTTTTCATCCGTGAAGC
GTGCTGGAGAGGTCGCAAGACGCGCAGTCCATTATTCAGGCGAGTCACGGTACTCTCACATAATTTGGAATTGAATGCCACAACTTGATTACGGCTCTGG
GTTGACTTCGCATTCCATTCAGCGTGCTGGATCTCACTTCAGTTTTGCCGACTTCCAGGGCGGAATCATCATGGTGAAGGTCGGCGAGGACGAGGACGAG
GGAGACCAGGGCCTGACGACCAAGGACCAGAAGGCGACAACAGCAGCTGCTGCAAACCCCATGAGTCCGCTCTCCTCGGAGGCGCTGATGCTGCGCGAGC
TGGAGCTGGCGCCCGTCCTCATGTACCCGCAGCAGGTCTCGCGCGCCACCGAGATCCGCCTCTTCCTCTCGCGCATCGAGTGCATCGCCATCCACCAGGT
CATCGAGCGCGAGGAGGGCGTCGTCTACTTTGTGCTGGATGTGTACCGCTACCGCCTGCAAAAGGGGCTCCCGTGCACGCGCAGCCGCCGCCGCAAACTG
TCGGCAGACCGCGAGCCCGAGGACCGCGGCCCAGGACTACCAGATCGAGCAGCGCTACTCGAGCTTCGCGCGTCTGCGCTCCAACGTGGCGCACATTGCG
CGCAAGCGCCACCCCAAGGGCAAGGCGTGCGGCTACTGTTCAGGCCTGCTGGATTTCCTGCACGTGACGCCGTGCAAACCTAGTCTCAAGGTCAAGTTCA
CGACCACCACCGAGGAGCGCAAGGGCATCCTCAGTAACTTCATCAACGAGCTGGTACACGTCGCGCGAGAGGACTACGCGTCGTGTCCGCGGTCGCTGCG
TGGCTACCACATTATCCCTGCGCTCATCAAGCGCTTCTTGTCGGAGCAGACTGGCGAGTCGTTCTTCACGTGAGAACGGGCATAGGTAGGTTGCAGATGA
AGTGGAAAGAGGCTTTGCAAGGACGGACGAAGGAGCAGGAAGAAGAAGAGATGTGAATTATGAACAGGTTTTGATATTTAAAACAACCAAGCGCGCATGA
ACACTCCGCCGTGGCAAACGCCAACTCGAGCGACTCCATTTTGACGAGATTTGTGCTCAGTCAACGCTGTGCCTAACTTCCAGCACATCTTTCGCTATTG
GTTAAAACTACTTTCCAGTCTTCCCATTGGCTTCTGCCTCGTGATATTTCTACTCGACATTTTTTTGCTGCCACGCACTTCGAGATCTGCCATTTCGTGA
TCGATGGCGCCGACA