Description :
From Genome Similarity Track
Location :
scaffold_674:11630- 13221
Transcript NameFunction/comments
Pl_103039hypothetical protein PHYSODRAFT_514580

Sequence
1591 bases(100 bases per row)
GTGCTGTGACTCTCACCTTGGTAAGACATAGACTTTAATGCGGTAGTGGGAGGACACCTACCATTGTCCCTCACGGCTCCTTCTAAAATGAAATTGGTTT
CGCCTGCACATGCCTCTTGAATGAAGTCAGAAGCCTTGCTCCCTTTCATTGGAGCCGCCATAGCCACCCACGTCGAGCTAGAGTCGAGTTTGCACTTCCC
TGTAGCAATTGCACCAGCCAACATTAGGTTTCCCATTGAGTGCGTGACGACGATTGTATCTGATATGATGGATTTCACGCTTGTTTTACTGACAGCGAGT
GCGCGATCGCAAACCTTCTGCTGCTGAGTAGCGTTGATCCACGTATTGTTTATCGTGTCAAGGACCATGTATTTAGTTGTCGTACAACACGGAGTATGGC
CAGTCAAATTTCCCCAGTACCTAAAAGAGTCTTGATTGTCCGGTAGCTCGAAAGGGCTTCCCATACCATGAATGAAGATGCATGGACGTGGTGTCGACTT
GCATGAACACGAAGGCGAATCATCTTCCCAAAAAAAGTCAAAGTTAGCTTTGAGTCTCCTCACCGCACCAGAAGTAACAAATTTGCCTGTAAGCAATGAC
TTCCCAGTCAATGTCACCGTGGTTGCTGCCACTGAAGTTGTGCATTCCGGTAATTTTTTGTCGTTTACTGCTGGTTTCGAGATATTCGCGAATTTATCAA
GGTATTCCACTGAAAAGTCGATGTCACTGCCATACATGTTGAATCCTGATCCAGAGGTGCACAATGCATAGTCAATATCGTTTACGGACACCTTGAATAA
ACTGTCGCTCGAGCACTCCACACCACTTGGCGCATTCGAAACCGGTGTAGCTTCGTTTACTGCAGCCACAATCGTGTTAATCGGAGGAAGGTGGTTCAAT
TCTGGTTCCTCACACTTTACGGTTGGAAGAGCAGTAGCGTTATGGAGATTCCTTCTTGAGTAGTACGCAGCTCCATCGACCAATGTGTAATTGTGGATGA
TTTCGTCTTCCATGAATGTGGCAAAGACGTTGTAATAAACGGAAGTTCCATCAATCGAGACAACGGGATCAGCGAGCATCGAGAAATCTGACGTGGCATG
TATCCTCATGGAACTGCGCTTGAGTGTGAAGTTAAATCGTAGCGAAGGCCATTCCGCCGTCGTGCTCTTAGTGTTAATCTGTGACTGCGCTTGGAAAACA
TTACTGGTTTTGCTGCTTGTAGCTGCTTGCACTATTGATACGACTAGCAGTGTCAGTGTGACTGTCACAAACAGAGGTGACTGCATCTTGACAGACCAGG
AGTTTGATAAATTAACAGTGTTGCGAATCGCAGCAAAATATCGCAACTTGCGATATTTTGCTGGCTGCGGGGTCCATTCTTCGTGAAAGCAATTCCTAAA
TTCAATCCTGAGCTCCAACGCCAGTACATTAGCGCACAATCCACCGACCGTAGTGTCCGATTACCAACGTACAACAAATACAAGGACCTTAAATTTTTAA
TTGAAACATTTGGATAGTACGATATACTCGTAATAGCGATAACACCACCAGATTTATAATAACAGCGACCTCAGTTAGAGTCCCTCCAACG