Description :
From Genome Similarity Track
Location :
Scaffold_964:1163- 3416
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_964-fgenesh-gene-0.0Serine protease family S33

Sequence
2253 bases(100 bases per row)
ACCTGCGCAAGACGGTNNNNNNNNNNTTCGCAGTCCCACTTTTGCGGAAATGGAAGTCAGAATGTCCTAATTGTGAGATATGGCGTCCTAAACAACGCGG
CCCAGATTGTCCTAATAACACCGCAGTCCTATACAAAAAGGTGAGCAAGAGGATTCTTTCCAAAATAGGGGGTCCCAGACTTCATCATCGGAACAGCCTG
GGACGCTAACGCCCAGCTGAGGCAGTGTCTTGCCGCATTCGCCATCGATACTTACTGCCTGCGCTGCACTCGACGTCACCAGCTGCCCGGAGTTCAACGC
CCAAGGATGTACAGCAGCTTATGTTACATTCGGTTTGCAACGCTTCACCCCTGTTACTCTCTAACAAAAGCGCATTCAACACATTTTAATTTCGGGTGAT
CAAATTGTTCAACATCATTCATGGCTCTGGCCTCTCAGGCCGCCTTGCCACGGTAGTGCGTCTTGTGTTCGCTAGACGAGGCTGCCGCCGCTCGCTCATG
CTCGTACGAAGCTGTCGACTGTTTGCTCGTGCTCGTGCGAGGCTCGAGTCTTGTGGTCGTTGTTGTTTTTGTGGACGAGGACGCTGGATACGAGAACACT
GAATATGAGGACGACCGTCCGCTGCGCTTCGTCTCGGCGCAGTTGCTGAGCGTTGACGAATTCGCTGAGCTCCTGCGCGACATGAAGCTGAATAAACAAT
AACGCTACCGAACTTAGCATCATCATTTGAAGCTCAGCAACCAGTTGCAGCTTGAATGGGGCTAGCCAATCGTTTCTGTCGGTGGCCAGCAACTGGTGTG
TTTCACGATCGATCTTGGAGACTTCAACTTCAGGCAGTAAGTCGAACCATCATTAGCACTGCTGATGACGGTAGCAGTATTCTGATTGGCTAAAAAAAAA
TGCGTGTCATGATTTCCGTTTTTCTGATGACGACAATGCGGATACGATTGGCTGAAAAGGAGTCAGCAGATTAATCAGGATTTGCGAACGACGACAAACA
AATCACCGTTAGCGAGCAACGAGATGCGGCCGAGCGCCGAACGCCACGAGCGGCTCATCACATCGACTCACCCGCAATGCATACGACTAATAATTCACTT
CCGGATCTGAAGCACAGAGAGCAACCACACGTGGCAGTCAGACCCTCAAGATGAGCTCCTCGCAGCAGCTCCGAGCCAGCCGTCCGCAGCCGCCACCACT
TCCTGAGCCGCTCTCGCTCGACATTGGCGGCAAGGCCATCATCAAGTACATCGACGTCAAGCCTGTGAACTATTGCGCCCGCAGCACACCAGCCATCGTG
CTCCTCCACGGCTCCCCAGGCAACTACAAGGACTTCCGCCACCTGATCCCGCTNNNNNNNNNNACCGCCGCTCCCGGAGGCGAAGTCTCTCGACATCGAC
GGCAAGGCCATCATCAAGTACATCGACATCAAGCCTGCGAACTACAGTGCAAGCAGCACGCCGGCGATCGTGCTCGTCCACGGCTCCCCAGGAAGCTACA
AGGACTTCCGCCACCTGATCCCGCTGCTGCAGAAGGACGCGCGCGTGATCGCGTTCAACCTGCCAGGCTCTGCTGACTCGGTCGTCACCGACAAGGAGAA
CCGCTTCGAGCACGTGAGCGCGCGAGGCGTAGCGAATATCGCGTACGAAGTGCTGGCGACGTTGTGCAAGGATGACGAGAGCGTGTTTGTCGTGGGTCAC
TCGTTCGGTGGCCACACGACCACCAACTTGGTGCATGCCAACCTCACGCAGAAGAAGCTCAACATCCGCGGTGTCGGATTGCTGGCATCCGCGGGTCATC
GTGCACATCGATCGCTCTGGCCATTCGTGACCAACGTGGTTTGCAACGTGGTTCGTGCAGGTCTTCCAATCGTCTCTCCTGCTGCGCAATCGTTCGTGCA
CGTCGTGTACACGAAGCTCGTTGGGTTCCCAAACAACGGCACAACGAGTCACTTTGTCTCTTCGCTCCTTCGAACGGACACGACCGACTACGCACTCGTG
AACAAGCAGCGTAAGGAGCTTTCAGAAGTCCCGGCGTTCGTGGCCTGGGCCAAGGACGACCCGCACATTGAAGAAGAACTCCCGCTGCGTCTGAGCGACG
AGTTCCGCCCCGGTCCTCGCTTCGCGTTCGACAAGGGCGGCCACAACATTCAGAAGACGCAGGCCGACGTGCTCGCGCTCGAGCTCATGCGCTGGATCAA
CGAGGTGCTCGCTGTCGCGAAAGAGCCGAGTTCGAGAATTCGCAGCGCTTTAT