Description :
From Genome Similarity Track
Location :
Scaffold_378:1163- 2379
Transcript NameFunction/comments
Aphas_H257_19308folate-Biopterin Transporter (FBT) family

Sequence
1216 bases(100 bases per row)
GGCCAGCGCCATGACTTTATAGTACCACTGGTTGCGAACGACGTCCCTGCAAGCAATACTTGACTTCGAAAGATGACTAGCCCGTCGACGAGGATCACGT
CGGTGGTGCCCGCAGCGAATGTTCACCGCTCATTTCACTACAGATCCAATAACGACACCATGAGCAGAATTCCAGAGTATCAACTCATTGTCTAGCATCT
TGTAGATCGGGTATGGACAAGTTGCCCAAGATGCTAGCCATTGAGTTGTTGAGGGATTCGACATCCGCCCAGTACATGGCCACGTGAAACCGTAACGCAA
ACCTTAGATGTCAATCGCCTCATGTATGGATCAATATTGGAACCGCCAGTACAACACGAGATATGCAATGTTCATTATACGCTACTTCAAAATGCAAGAC
ATTTTTTTCTACTTCTGGGGGCACTTGCCCGTCTTGGGGTCCAACACTCCGTTGCCCCCTGCGACACGGTAGCACTTGGTGGAGGGGAAAATGGACATGA
TGTTGCTGGACACGGTGAACGACACGCAGAAGAAAAACACGGACACGAGAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNN