Description :
From Genome Similarity Track
Location :
Scaffold_60:116206- 118395
Transcript NameFunction/comments
Phyin_T30-4PITG_17551Putative uncharacterized protein

Sequence
2189 bases(100 bases per row)
CGGAAGTTCAATACGTTTACACGGCGATCGTCTCGGCCGGATGTGTCGTTGAGTGACTCGACGAACTTTGACTTCCTGCACGTATCAGCTCCTCGTCGTG
AGCCTGTTATTCAAACATCAACGTCACCACGACAAAAGTGCGCGGAAGGGCATCCACCTGTGGCTACCTTTTACGGATATCGCAGTGTGCCTCGGTCTGT
TGACGCTCGCGCTCCCGACTCCTTCTCGCTGTGTCCCTCAGTTACTTCACTAGCTGTCAACGCTCATCGACCGAGTGACAATCAAAGCTGTCTGCCTACT
GCGAAGCCATTCCCACCAGCTCTGACACTCAACAGCTCCAACTTCCACGCAGCACCCAACCAGTGCAAAGTGTATCAGCAGGCGAAGTACAAGTTGGATC
CAGAAATGTTCCAAGCTCACCAAGAGACTTTTTCTACCTGTTTTGGTGCAGTGCCACTGAACAATCGATCGCAAAACTTAACCAGCGGTCCGCGTGTCGT
CGACTTTGGTCGTGGGAATCTCCTCCGGCTTCAAGAGTTCCTCACTGTCCGTGGACTGCACCGCCTGAGCCTAACGTCACATGCATGGTGCGATCTGATC
ACAACGCCGTCATCCTATAGTGACGCGCTGTGGGGTGTGCACGCTCTAAGGATGTGGAGACCTACTGAGGGTAGCGACGACTTCTTACTCGACATTGGCG
TGCTTAAGAAGCCCGAGCGACCCCGGCGAATGCTGCAGATACTTACGCGCCAAGTGTCTCGCGTTACGGTGGAAAACATGAAGATACTGCTCAATCCTGA
AAGCTGGCAGCTAGCGACAGTAATGTCTCCACCGGGAAGCAAAACTATTCAATCGCTGCAAAATGCTGTGGGGGGCAAGCGAGATCTGCCAGCGACGTAC
GATGAAGGGGGACTCTCGCCTCGTCGACAACGGACAGCTGAGTTGTTCGAACAGATCATAGTCATCTACAACCGTGCGGGTGAAATTGTAGCAGTATGTG
CTAGGCAGCTGATTCGACCAGTAGACCCCATGACAATGCTCACGGACATTTTGCATGGCCTCAGGAGTGGAGAGCTCTGTCGCGTGCACTGTCGGCGTCT
GCGGCTTTTTTCACAGACGAATAGGTTGCCGTTTGAGCAGTGGACGCTGCTGCCGCACTGCAGTCGAATCGTTGTAGAGTTTTTCTGGTCGGACGGAGAA
GCGGATGCCGCAGTCTGCTCACCCCCGTCTCTGCCTGTATGGCACCAGAAGATCCTGAGCAAGCTCCAACATGGGCTGCAGCAGCGTCTGCTGGGCAAGG
ACAGCGTCAACGGCGTCATCAAGCTTGCCCACGACCAGAATGCTTCGACTGCCGTACTTTTTTTGCTCGAGAAGTTCCTTTCACGCTGTCAATTCACCGC
CAAAGGCTGATTAGTCAAACGGATGGCTACATTCTGTGATTACGCTGGGAGATGATTACCAGTGGCTGACGAGAAATAGGTACAGTGTACCACCCACCGA
GATTCCATGGCAATTCATAGCTCCACGCTGGCCTTTGGAATATAGCTCCATCGTGCGATGTCCTGCACGCGGTTGTACTCATGGTGGACAGCTAAACGAA
GTGCGTAACCTACATGCATTGCCAAACGGAGGATGACGACTACCGTGTGCTACTTTTCGCATTTTCCTCCCGCTGGGTATGAGAACAGCGCATTTTCATC
CTAATCCTCGACACTGTCGTGTTCAGGTGAGTGCCATTGATCTTGTCAGGCTGTTGTCGCCTCACTCGACGGACACCACCGTGCAAGTGACGCATCGCTC
GTGCTCTCACAAGAGTTTTCATGGGCTTTGCCGAAGGCGTGAGCGACTGCGCTGTCAGAAATTGTGTGCAGCATCCACGCACGCTGTGCCGCAACCGGTG
TAGAAAATCCGATCGTCCCGTAATGATCACTTCAAGGCGTACCCATCAGCGATGATCTACGAGAGTGCACCACGGACAGTTGCCCGATCCTCACGCACAG
CAAAACGAAACGTGTGCCCTGCCAAAAAATTGTGCCCAGCTGGCGACAGTGTTTCTAAGGAGGAGACTGAGGCGGGAGGCTACAGTCTGTATCGTTTTGT
CATGGTACAGTCACAGTGTAGTTCTAGATGTACAGGCTGTAGTACAGCCGTCTATTGGCATCTGCTTACAGTACTCTGTAGACAGAAGC