Description :
From Genome Similarity Track
Location :
Scaffold_283:1162- 6214
Transcript NameFunction/comments
g15766.t1XP_009533065.1 hypothetical protein PHYSODRAFT_563428 [Phytophthora sojae
g15767.t1XP_009533065.1 hypothetical protein PHYSODRAFT_563428 [Phytophthora sojae

Sequence
5052 bases(100 bases per row)
TACTGAAGAAATAGTTGTCTAGCTCCCATGCTCAGAAGAACTGGGTGAAATAGGTGAAATAGATCGGTTGAAGAGCTCGAAGATTGATCCGGTGTTTCTT
GTCGTCTGCTAAGAATGGTCAATTCGGCTTGCCGACTCAACTCAGCGGCGTGATTTCCTCGTAACATGTATGTCAGCCGCATCGGATCGGACCTTGGACT
CTGGGGCTCGGTCGCTTGATTCCCTAAACTTAAAACGACCAGGATTCATCAGGAGAAGTTGATCGGTACAAATTCAGTCGTTGTGTATTACCAAACTAGC
TACCTGCTACTACTTCGTAGCAAAGGACAACACATACACACTCGGTCGAGCGAATCGACCATCTCTAACATGACCAGCAAAATTAATTCGCAGCGCTGAC
GTTGTAGTACACCGTATTCTCGAACTCCGGCGCACAGTACGGGAACTCCGCCTCCTCGTCCGACGGAGCAAACAGCTCCTTGCCCGTCGTGTAAGTCACG
TAGCAACCAAGCACAAAGCAGATCACCACCACGATGCTTCCCGAGGCCTTCTCCCACATCGCAACCTCGCCCCACGACTTCTTCAGGTAGAAGACGATAG
GCAGCAAAATGCAGTTCACCGTGATGCACGAGGCACCAACGAAGTCTGCCAGGGACGTGAAGTCGTCCTTCAGCACAATCGAGATAACGACAAGCACCAC
CACGAGGATGACACGCAGCACGACGTACTTGATGGCGTTCGCACCGCGGTACTCCATCGCTTCTTTCTCGGCGTCGTCCTTGTGCACGTTCTCGGCGTCG
GCCACCGACACGTACGACATTTTGGAGCTTACGGACAGAATCTTTCACGGGCCGGGTCAGCCGGGGGTTAGACGTGTTGCAAATAGCTGGTGGCGTTCTC
CAGGTCCTCCTGCACCTCCTTGTGCATGCCCAGGACAGACGCTCCGCGATGTAGAACGCCGGGTTGATGATCACCGCGAAGGCGATCGTGACGTGCAGCT
GCATGAAAAGGTATGCTAGCACGATGGTTCCCCAGTTCGGCGCAAAACCCAGGTTGGTGAGGCCGGTCTCCGAGTCGGGGTAAATGGTGAAGAGCAGGTT
GCCCGAGATCTGGCAGCCCACGGCCGAGTACGCGGTGCTGGCCAGGACCAGGAACAGGATAGAAATGATGCCGACGGTGACGCCCACGACGCGTGGCATG
CGCTTGGGGTCGCTGTGCTGGCGCTGGATGTCCGGGATCACGATACCAGCCCCGTAGGCGAGCGACAGGTTGCCGAAGCAGCCAGCGACCTGCTCGAACG
AAAGGTCAGGCGTCGGCACGCCCCGGGGGGGAGGCGGGGGTGGCGGGGGGGGGGGGGGTGGCCGCTGAGTCCGTGCATGAACCACAGCCACGCCGCGAAT
CGCAAGATCGTTCCCAGCATCCGCAAGGCGCCCAGCTCCTTCCATTCAGGGTGGGCACAAGCACACGGCAGCACCATGAGGCGCCATGAAGATGAATCCA
CGTGTTCTGGCAAGGTCCGAAGAGGCCATCCAGCAGTGAACCACCGAGCACCAAAAAGACGCACGGGATAAGTAGGCACGAACCCATTTGTGAGATAACA
GCAGCCAGCGACCAATGCGGCCCCATGCACTACTGCACGAGGTCTCCAAAAAGTCTTGACCGCGACATTGGCGCGAGCAAGCATGACTTGGACATGGTAA
ATTGACGCGTAGAGTTGCGAATGCCAAATGAAACCATGCAACAAAGGCGAGTAAAGCCGGCGCGCGAGAAGTTGCCGGGCATACCAAGAGTACCAACGCC
GTAGATGCAGCAGAAGAGGTTGAAGGCCGACTTGGCGTCCTCAGCGGTGAAGAAAGGTCCCTTAGCCATGGTTGTCGGGGCGAAGGCGCGAGGCAAAAAG
AACAGGGGCTACGGATCGAGCGCGCTGCTGATCAGGGGGTTGCTTGAGTTGGAGGCAGCCAAATTGAAAATGATGAGGTGGGGTGGAGCCGTCGGCAGGC
AACCACACACAGGCCGCATGTGGCCGGCAGCTGTACTATGTGTAGCATGAAGCAGGACGCCAAGATTGTGCGGGAAAGGATACATGTACGGGACCAACTG
ATTAATAAAGTTTTAGTCAATTCTGCAGATCAATCGGTCTCACGTCAACATGCCGGAAATACAATGTACAGAGGTCCCTCTCAATAAGCGCATGGACTCC
GTGGCGGAGGTTGGTGAGGCGATTTCAGAGGGATTAGAGATGGTGTAAGCGGATCGGCTCAGTGTACTGTAGCTATTTTGCTTCAGCGTTCGGTTATGTC
GGGGTATCGAAACGACGAGGCTTATTGAGAGGGACCTCTGTGCTGTACGTCCACCTGCGAGCGTACGCCGTTGGCCCCTTCTTGGTACCAGTGTTCAGCG
AGGGCCTTTTCTGCCTGTTAAATCCATGCCGCTGTCGGAGGTTTCAACGCTCGCTACTGTGGAGCTGCTGGGACAGCTCTCTAGTAACACCGATGGGGTC
CGCGCATCGGCCAGACCAAGAAACTGGCGACTGAGTGAGTGCTGCTGAGTGAGTGCTGCTGAGTGAGTGATGCCTCCACGAGCGCATTGCGGCTTTTGGA
AGTTGCTGTAGGCTACATATCCTTTTTCTATCTATACGGTTCGCATCAAGTACGATTGTGAGTGATAGTTTCTCTTCAAAGAGAGTCGCCCGCCTGTGCG
CCGTCATCACCTTGAAGCGGAAAGGAGGGGAGGTGATTGGCGTAGCGCGCGGCGATGCCAGCACTGTCATTGCGCACTTGCAGCGAAGGCAGCTCGGCGA
GGTCGACGGAGCGGTGGCTTGCGATGACACGCTGTCTGAGACCTTCATAGTCGGTGTTCTCTCGACTATTCCTACAGCGGGGATTCGTTTCCTTCGTGGA
GATCAAGCTTTTTGCACACGACAGACAAGTCACTGGCCCAAGTGGCCTTACTAGCGCTGCAGTATGGGACGTCTCTCCATACTATACACGTAGGTATTAA
AATAATGGCAACGTCGTCTGGACTGGATTCAATACATATTAGTAATCGCATCCACAGCGAAAAGTGAATATGTCGGCATGCACTCGCACAGCGAGCGTCG
ACATCGAACAAGAAAAGCGATTTTAGTCGCCAAAAAAGAAAACTGAAGAAGATTGAAAACAATTGCACCGGAAAATTAATTTATATGAAGTACAGTACAG
TGAAGTATCTTGATAACATGTACATATTAGATCGAACTCACCATTACCATAAACGACAGCAAGCCACCTTATGCAAGCAATAACTATACCGCCAAGAGTT
TGGCGGATATCTACATGTATCTTTACTTTTTGGTAGGATTAAGGCAGGCTGACTGTTACCGGTCCATGTACTGGCTCAAGCGATATACAGATTCCGCCCT
CCAATCCGTCCCCGTAGACGGTGGGTTGCCGCGTTTCGTGTCGATGCGTGCTGTACATACATGTGCCGGTACCCGTACAAGCCACCGCTCCGGCGACCTC
GCCGAGCTGCCTTCGCTGCAAGTGCGCAATGACAGTGCTGGCATCGCCGCGCGCTACGCCAATCACCTCCCCTCCTTTCCGCTTCAAGGTGATGACGGCG
CACAGGCGGGCGACTCTCTTTGAAGAGAAACTATCACTCACAATCGTACTTGATGCGAACCGTATAGATAGAAAAGGATATGTAGCCTACAGCAACTTCC
AAAAGCCGCAATGCGCTCGTGGAGGCATCACTCACTCAGCAGCACTCACTCAGCAGCACTCGATCGCCAGTTTCTTGGTCTGGCCGATGCGCGGACCCCA
TCGGTGTTACTAGAGAGCTGTCCCAGCAGCTCCACAGTAGCGAGCGTTGAAACCTCCGACAGCGGCATGGATTTAACAGGCAGAAAAGGCCCTCGCTGAA
CACTGGTACCAAGAAGGGGCCAACGGCGTACGCTCGCAGGTGGACGTACAGCACAGAGGTCCCTCTCAATAAGCCTCGTCGTTTCGATACCCCGACATAA
CCGAACGCTGAAGCAAAATAGCTACAGTACACTGAGCCGATCCGCTTACACCATCTCTAATCCCTCTGAAATCGCCTCACCAACCTCCGCCACGGAGTCC
ATGCGCTTATTGAGAGGGACCTCTGTACATTGTATTTCCGGCATGTTGACGTGAGACCGATTGATCTGCAGAATTGACTAAAACTTTATTAATCAGTTGG
TCCCGTACATGTATCCTTTCCCGCACAATCTTGGCGTCCTGCTTCATGCTACACATAGTACAGCTGCCGGCCACATGCGGCCTGTGTGTGGTTGCCTGCC
GACGGCTCCACCCCACCTCATCATTTTCAATTTGGCTGCCTCCAACTCAAGCAACCCCCTGATCAGCAGCGCGCTCGATCCGTAGCCCCTGTTCTTTTTG
CCTCGCGCCTTCGCCCCGACAACCATGGCTAAGGGACCTTTCTTCACCGCTGAGGACGCCAAGTCGGCCTTCAACCTCTTCTGCTGCATCTACGGCGTTG
GTACTCTTGGTATGCCCGGCAACTTCTCGCGCGCCGGCCCTTACCTCGCCGTTGTTGCCATGGCTTTCATGGCCTTCGCCAACATCTACGCGTCCATGAC
CATGTCCAAGGTCATGCTGCTCGCGCCCAGGTCCGTCAAGACGTTTGGAGACCTCGGTCAGTGGTGCATGGGGCCGATTGGTCGCTGGCTGTGTATCGTC
TCGCAAATGGGCTCGTGCCTACTTATCCCGTGCGTCTTCCTGGTCCTCGGTGGTTCACTGCTGGATGGCCTCTTCCCGGGAGCCTTCAGCCAGACGACGT
GGATCATCTTCATGGCGCTCATGGTGCTGCCCGTGTGCTTGGTGCCCACCCTCAAGGAAGGAGCTGGCGCCGCCTTCGCCGGATGCCTGGGAACGATCAT
TGCCGACATCATCGGCGTGGCTGTAGTCATACACGGACTCAGTGGCCACCCGAGCGTGCCGACACCTGACCTTTCGTTCGAGCAGGTCGCTGGCTGCTTC
GGCAACCTGTCGCTCGCCTACGGGGCTGGTATCGTGATCCCGGACATCCAGC