Description :
From Genome Similarity Track
Location :
Scaffold_436:1162- 5232
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20314hypothetical protein

Sequence
4070 bases(100 bases per row)
AGATGGGCTGAGAACGTGGCCGGCCCACGAGTTCCTGCACGTCAAGCGAGACTGGAACCAGAGCACAGATAGGATAGCCAACACCGCATTACACCAGCAA
GAAGGCACAGTGATTACTTCGGTGGCAGACCACGACGATTTGGTTGTCCTCAACCGGCTCCAAGAGCTCCTACTCCCGAAGGACGAAGGGTCTGTCGTCC
TGATGGCCTCAACGACTTGATCGCTACACGCTCGAATATCTCGGCGGAGGTGCTACAATTAGATGTGGTTCAACGCATTAGGACGGATCGGATTCTGCGA
GCACAGAACGACGAGAAATGGTTCGTAAAACTTCAAGGCGTACCTATCAGGCGACTTGGAGGACCTGGATGCTGGCGAAGCGCGAGCCTGCGGTAAAATC
GCGGGCAACTTCGACGTGGACGACGGTGGGCTGCTTCTTTACTGCCCCCGCGCAGGAAGAGACGACGGTGACCGCGATTGGCTGGCGAAGCTGGTGGTGC
CGAAAGACCTACAACAAGATGTACTTCACCATTATCACACGAGTCTGGAGGGAGGACATCAAGGGGTCGGTAGAACGTACCAACGAATCAGGACGCACTT
TCACTGGCGTGGTGTATTCAAGAGTGTGCAGCGATACGTGGGACAATGCACGGGTTGTGAAACCGGGAAAGGGCGTCCGACTCTACGCGTAGTGACGCCA
GGCAACATTCAAGCAACGTACCCTTTCCAGTGCATCGCGATGGACCACATTCCATCTCTACCAAGGTCGTGGGAACACCGAGCTGCTCATCTGGGTCGAT
TTATCCACAGGCTACGTGATAGCCAAGGCTAGTGTGTCACGGACAGCGCAGACGATCGCGGAGAACTACGAAGAGTACGTCTTCCGCAGATTTGGAGCAA
GCGAAGCCATCCGGCACGATCGAGAGCCAGGATTCATGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAGCAAGAAGACTCGATACGGCCGTACACGACGCGAGTACCTGGTCTTCTGGAAGGGCTACGCCGAGCCGTCGTGGGTCGATGAAAC
TAATCTCAACTGCGGAGCGTTGCTAAGAGACTTCGACCGGGGAGGGACAGATCGCAACCGGTTCGAGGCGATGCAGTCACATGAGGATTAAGCGGTGGAA
AATCTGCGGTCGGCTGGCCACTCTGGAGAAGCGAGAGGAAGAAGGATCTGCAGGAAGGCTGTAGATTTCAAGGAGGAGATGGTGCATATGGAGTGCCGTG
GGCCTGAATAGGTCAGAAACCCTAGGCAACACACCCTCGCAAATTCCGAAAGAACAGAAGAAGATACGGATGGATTAAGTCGAGCCAGATCGGACCAGGT
CTTCTGAACGACCTACAAGTTGCTACCGAACACATAACGGCAGGATGTAATTAGGAAGAGGATGACACGAACTTGCCAGGGGCAAGCGAGCGATCCCAAG
CGCCGGGTGGTCCCCTGGTGCGTCACGATAGTGATTGCGCCAGCGATCGGCAGTGTCCGTGATAGCCAACACCTCCAGTAGATCGGCAGGATCAGCTCCG
TCTTTAACGCCAGGATAACAAGCACCCGCCTCGTCGGGCCGAGGGAACTGCAGGAAGAAGGGATCCAGCAACAGGTCACAGTAACCCCGGAGCAAACCGA
TCAGCACCTGTTGGAGGAACGGTTTCCACCGGGCGCCGGTTCTGGACCGACGCTGCTTGCGATCAGTGTAGAACGCTTCCAAGTACTGACTGGCCCTCGT
ATTTGGCGATGCTCACCGGAAATGCGTGAATGGAATCCCAATAAGCCCGAAGATGCTCATCCTCGTAGGACGCGTAGATTCGCATCATGTGTCGGAACCA
ACCTCGTCCTTGGAACGTGAGAGGATCGATCTTGGCAGCAAGGATCTCCCACGGAGAGGACTCGATCAAGTTGCGTACGTTACTCTCGTCCACTAGATCG
TCTCGCCACTATCCAAGCGGAGGCGCGGGATCGCGGAGAGCGATTAGCCATTCCATCGGCTTGGCAAAATGATGGAACAACAGATCCGCGTTCATCTTCA
CGATGCTTGTCTGTCGAATATCCTGCGCAGACCAAGGGACGATATCATGACTGCGGAAGCTACGACGGTCACGATAACCGGGGATCCACTCCGATCGGGG
AACCGTGGTAGGCGGTAGATCCGCCAGCTCAGCATCCAATAGAGGGTTAGATGGCATTCCAAACTGGTCCCGGACACGACTCAACTCCGGAGAACCACTG
TCGTTTCCTGCGGCGTCCGAATCAAATACGCGAGTAGAACTGGATTTGCCGGAGGAACTCTCGCCGCCGTCGGAGAGCACGCCCTACTCGGATTCTGCAG
AAAGGGACGAGGCACCTCCGCTACATCCTGTGTGGTAGATCGAGTAGATCGAGGAGGAGGATCAGGAAGGCCAGCGAACAAAGGGGGCGACACCGGCTCC
TCAGCCTTCTGGTCGGCAGCTACGGCAGACAACACCTCGATCGAGGACCTAGATGCAGGACCCTCACTCAAAGCACTAGTCGAGAAGGGACCTGGAGTTG
ATCGAGCAGCCTTGGAGACGCGAGCAGGCGGAGCTGGAGAATCGGGCTCAGAGCGCGTTCGTTTATGACCCAGGGTTGAAGGGAGTAGGGACGCGAAGTT
CGACAACCTCTCCTGCGCCTGGTCCCGTTCGGCCCGTAGATCAGTGACCTCCGTGAAACGCCAAGCTGGCCGAACAACTCATCTCTTTGGACTGCCAGAC
TGTCTCTCTCTTGTCGAAGTGCTGCGAGCGCGATCTCGAGGTCTTTACGCGCCTTCTGAGACTCCTCGACCTGGTTAACCAGGCGATAGTATCCCGAGCC
GATCCGCTGTGACACAGGACATGAATTAGTACGAATCCGACAAGGGAAGGCAGATAATACTCACGGGTGGCGTTACGCTCTATCCTGGCCTGATCACGCT
GGGAAGTCGCCGTGCGGATGCGCTGGGAACCATGCTGAAGGTCCTGAGTTAGTGTCAATACCCGATCCCGCAAACGAACAAGCTCAACGGAACGTGCGGT
GATCGTGATCGTATTGCCGACAACCTTCAAGCGACGCTCATAGCTTTCACGCAACGTACGGATGCGACAAGTCTTACGCTCGATCGTGGCCTCAAGGCGA
TCTACTTCTGCTTGAGCAGCCTGTTGGGACGCAGCCGATTCACGGAGCTCCGAAGCGAGAGAAGACTGGCTGTAACGGGGTTACACGCAAGTGGCTACAT
GTAGCCACTTGATTACGACAATGGGTTTCACATTGGTGTGAGATACACCAATGGTTACATTTGACAGACC